Notice: Due to a server issue, SGN was unavailable earlier today. We apologize for any inconvenience.

SGN Marker C2_At5g54770

SGN-M9077
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle300441 (SGN)
121376 (CGN)
---
Capsicum annuumSingleSGN-U197116---
Lycopersicon CombinedMultipleSGN-U212885---
Solanum tuberosumSingleSGN-U244235---
ArabidopsisSingleAt5g54770 on TAIR---
Mapped locations  
Map: Arabidopsis COSII   
Map version
44 (location: 27549)
Chromosome
5
Position
22.26 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII

PCR data   Exp. ID 41866
Forward primer (5'-3')
AGGTGCTTGGCTAGGTGGACAACTC
Accessions and product sizes
Solanum lycopersicum TA209
320
Solanum pennellii TA56
360
Approximate temperature
55°C
Reverse primer (5'-3')
TGCCTAGCTCGTTCAAGAAAAGATG
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
320
Solanum pennellii TA56
360
Mg+2 concentration
1.5mM
   Enzymes
  
Other PCR data 
PCR data   Exp. ID 12022
Forward primer (5'-3')
AGGTGCTTGGCTAGGTGGACAACTC
 
 
Mg+2 concentration
3mM
Reverse primer (5'-3')
TGCCTAGCTCGTTCAAGAAAAGATG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 100
Approximate temperature
55°C
  
PCR data   Exp. ID 12023
Forward primer (5'-3')
AGGTGCTTGGCTAGGTGGACAACTC
 
 
Mg+2 concentration
3mM
Reverse primer (5'-3')
TGCCTAGCTCGTTCAAGAAAAGATG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 100
Approximate temperature
55°C
  
PCR data   Exp. ID 12024
Forward primer (5'-3')
AGGTGCTTGGCTAGGTGGACAACTC
 
 
Mg+2 concentration
3mM
Reverse primer (5'-3')
TGCCTAGCTCGTTCAAGAAAAGATG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 100
Approximate temperature
55°C
  
PCR data   Exp. ID 12340
Forward primer (5'-3')
ACTGATGTTGTCATTGTTGGTGCTGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTCCATCAATTTCAGCAACTTCC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 12341
Forward primer (5'-3')
ACTGATGTTGTCATTGTTGGTGCTGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTCCATCAATTTCAGCAACTTCC
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 1100
Approximate temperature
55°C
  
PCR data   Exp. ID 12342
Forward primer (5'-3')
ACTGATGTTGTCATTGTTGGTGCTGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTCCATCAATTTCAGCAACTTCC
Enzymes
  
Accessions and product sizes
Solanum melongena TA2986: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 12343
Forward primer (5'-3')
ACTGATGTTGTCATTGTTGGTGCTGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTCCATCAATTTCAGCAACTTCC
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 900
Approximate temperature
55°C
  
PCR data   Exp. ID 12344
Forward primer (5'-3')
ACTGATGTTGTCATTGTTGGTGCTGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTCCATCAATTTCAGCAACTTCC
Enzymes
  
Accessions and product sizes
Coffea canephora BP409: 650+1100
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]

Genomic location of C2_At5g54770  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D9077 marker 9077
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)