Notice: The SGN server upgrade is complete. Please let us know if you find any issues. :-)

SGN Marker SSR237

SGN-M910

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 55 High: 55
Repeat motif: AT   Repeat number: 11
Repeat motif:    Repeat number:
Forward primer: GTGGTAACGGCAAAGGGACT
Reverse primer: CTTATGGCCTTAGCAGCCAG
Predicted size: 178
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39195)
Chromosome
9
Position
50.37 cM
Confidence
I
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 114
Forward primer (5'-3')
GTGGTAACGGCAAAGGGACT
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
CTTATGGCCTTAGCAGCCAG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 160+191
Solanum lycopersicum LA925: 191+191
Approximate temperature
55°C
  
Genomic location of SSR237  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D910 marker 910
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)