SGN Marker C2_At5g58220

SGN-M9117
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle307573 (SGN)
125735 (CGN)
---
Capsicum annuumSingleSGN-U201105---
Lycopersicon CombinedSingleSGN-U217029---
Solanum tuberosumMultipleSGN-U260347---
ArabidopsisSingleAt5g58220 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38898)
Chromosome
1
Position
47.90 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 40000
Forward primer (5'-3')
AATCAACAGCTCTGTCCACTGCTACTG
Accessions and product sizes
Solanum pennellii TA56
150
Solanum lycopersicum TA209
150
Approximate temperature
55°C
Reverse primer (5'-3')
TTCTCCCTATAGCGAGCATTCCAC
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
150
Solanum pennellii TA56
125
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 27590)
Chromosome
5
Position
23.57 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 12043
Forward primer (5'-3')
AATCAACAGCTCTGTCCACTGCTACTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCTCCCTATAGCGAGCATTCCAC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 150
Approximate temperature
55°C
  
PCR data   Exp. ID 12044
Forward primer (5'-3')
AATCAACAGCTCTGTCCACTGCTACTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCTCCCTATAGCGAGCATTCCAC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 150
Approximate temperature
55°C
  
PCR data   Exp. ID 12045
Forward primer (5'-3')
AATCAACAGCTCTGTCCACTGCTACTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCTCCCTATAGCGAGCATTCCAC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 150
Approximate temperature
55°C
  
PCR data   Exp. ID 12046
Forward primer (5'-3')
AATCAACAGCTCTGTCCACTGCTACTG
Digested band sizes (using HaeIII)
Solanum pennellii LA716: 150
Solanum lycopersicum LA925: 130
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCTCCCTATAGCGAGCATTCCAC
Enzymes
All possible enzymes for pennellii and and lycopersicum: HaeIII
  
Accessions and product sizes
Solanum lycopersicum LA925: 150
Solanum pennellii LA716: 150
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text

Genomic location of C2_At5g58220  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D9117 marker 9117
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)