SGN Marker C2_At5g59960

SGN-M9134
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle312113 (SGN)
126174 (CGN)
---
Lycopersicon CombinedSingleSGN-U227690---
Solanum tuberosumSingleSGN-U246751---
ArabidopsisSingleAt5g59960 on TAIR---
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49306)
Chromosome
11
Position
53.38 MB
Confidence
uncalculated
Protocol
CAPS


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47246)
Chromosome
11
Position
124.00 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46783)
Chromosome
11
Position
80.60 cM
Confidence
CF(LOD3)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Eggplant-COSII   
Map version
63 (location: 42266)
Chromosome
12
Position
71.80 cM
Confidence
F(LOD3)
Protocol
CAPS


Eggplant-COSII

PCR data   Exp. ID 43835
Forward primer (5'-3')
TCCGATACTCATCAGCTCTTGTTC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
ACGCCTTGTGTTTGTTTGGATGTC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Pepper-COSII   
Map version
58 (location: 41545)
Chromosome
11
Position
59.60 cM
Confidence
F(LOD3)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43521
Forward primer (5'-3')
TCCGATACTCATCAGCTCTTGTTC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
ACGCCTTGTGTTTGTTTGGATGTC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38902)
Chromosome
11
Position
103.00 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 40004
Forward primer (5'-3')
TCCGATACTCATCAGCTCTTGTTC
Accessions and product sizes
Approximate temperature
Unknown
Reverse primer (5'-3')
ACGCCTTGTGTTTGTTTGGATGTC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 27608)
Chromosome
5
Position
24.16 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 12051
Forward primer (5'-3')
TCCGATACTCATCAGCTCTTGTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACGCCTTGTGTTTGTTTGGATGTC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 12052
Forward primer (5'-3')
TCCGATACTCATCAGCTCTTGTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACGCCTTGTGTTTGTTTGGATGTC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 12053
Forward primer (5'-3')
TCCGATACTCATCAGCTCTTGTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACGCCTTGTGTTTGTTTGGATGTC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 12054
Forward primer (5'-3')
TCCGATACTCATCAGCTCTTGTTC
Digested band sizes (using HinfI)
Solanum lycopersicum LA925: 750
Solanum pennellii LA716: 250+400
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACGCCTTGTGTTTGTTTGGATGTC
Enzymes
All possible enzymes for pennellii and and lycopersicum: HinfI
  
Accessions and product sizes
Solanum lycopersicum LA925: 750
Solanum pennellii LA716: 750
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA
Forward amplicon sequence for S. betaceum 285028 plant #2, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 285028 plant #2, plain text
Forward amplicon sequence for S. betaceum 6002056 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002056 plant #1, plain text
Forward amplicon sequence for S. quitoense plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #1, plain text
Forward amplicon sequence for S. betaceum 04T130, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 04T130, plain text
Forward amplicon sequence for S. betaceum 04T132, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 04T132, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text

Genomic location of C2_At5g59960  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D9134 marker 9134
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)