SGN Marker C2_At5g60600

SGN-M9140
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
Capsicum annuumSingleSGN-U202397---
Lycopersicon CombinedMultipleSGN-U214196---
Solanum tuberosumSingleSGN-U245286---
ArabidopsisSingleAt5g60600 on TAIR---
Mapped locations  
Map: Eggplant-COSII   
Map version
63 (location: 42268)
Chromosome
12
Position
112.60 cM
Confidence
I(LOD2)
Protocol
CAPS


Eggplant-COSII

PCR data   Exp. ID 43837
Forward primer (5'-3')
TCTCAATGAAAGCTAGCAATCCAG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
CAAAATAACGTCTGTGCTTTTCTTC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38905)
Chromosome
11
Position
79.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 40007
Forward primer (5'-3')
TTGCTTCAAGGTTGCAGAATGCG
Accessions and product sizes
Solanum pennellii TA56
1200
Solanum lycopersicum TA209
1200
Approximate temperature
55°C
Reverse primer (5'-3')
ACCAGGCAAGTGTGACGTCTTCTCTC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
300
Solanum lycopersicum TA209
450
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 27615)
Chromosome
5
Position
24.38 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 12062
Forward primer (5'-3')
TTGCTTCAAGGTTGCAGAATGCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCAGGCAAGTGTGACGTCTTCTCTC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 12063
Forward primer (5'-3')
TTGCTTCAAGGTTGCAGAATGCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCAGGCAAGTGTGACGTCTTCTCTC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 12064
Forward primer (5'-3')
TTGCTTCAAGGTTGCAGAATGCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCAGGCAAGTGTGACGTCTTCTCTC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 12065
Forward primer (5'-3')
TTGCTTCAAGGTTGCAGAATGCG
Digested band sizes (using RsaI)
Solanum lycopersicum LA925: 250
Solanum pennellii LA716: 80+120
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCAGGCAAGTGTGACGTCTTCTCTC
Enzymes
All possible enzymes for pennellii and and lycopersicum: RsaI, HinfI
  
Accessions and product sizes
Solanum pennellii LA716: 250
Solanum lycopersicum LA925: 250
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Genomic location of C2_At5g60600  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D9140 marker 9140
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)