SGN Marker C2_At5g62530

SGN-M9159
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeMultiple303223 (SGN)
123124 (CGN)
---
Capsicum annuumSingleSGN-U197594---
Lycopersicon CombinedMultipleSGN-U214573---
Solanum tuberosumSingleSGN-U246119---
ArabidopsisSingleAt5g62530 on TAIR---
Mapped locations  
Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46786)
Chromosome
6
Position
26.60 cM
Confidence
CF(LOD3)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Tobacco N. acuminata   
Map version
89 (location: 46538)
Chromosome
6
Position
41.70 cM
Confidence
CF(LOD3)
Protocol
CAPS


Tobacco N. acuminata

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38912)
Chromosome
6
Position
55.50 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 40014
Forward primer (5'-3')
TTCGACTGGAAGATCCTTGGG
Accessions and product sizes
Solanum pennellii TA56
200
Solanum lycopersicum TA209
200
Approximate temperature
55°C
Reverse primer (5'-3')
TGATTCAGCTGAACACTTCTGACC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
200
Solanum lycopersicum TA209
100
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 27636)
Chromosome
5
Position
25.12 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 12090
Forward primer (5'-3')
TTCGACTGGAAGATCCTTGGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGATTCAGCTGAACACTTCTGACC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 200
Approximate temperature
55°C
  
PCR data   Exp. ID 12091
Forward primer (5'-3')
TTCGACTGGAAGATCCTTGGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGATTCAGCTGAACACTTCTGACC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 200
Approximate temperature
55°C
  
PCR data   Exp. ID 12092
Forward primer (5'-3')
TTCGACTGGAAGATCCTTGGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGATTCAGCTGAACACTTCTGACC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 200
Approximate temperature
55°C
  
PCR data   Exp. ID 32587
Forward primer (5'-3')
TTCGACTGGAAGATCCTTGGG
Digested band sizes (using DraI)
Solanum pennellii LA716: 200
Solanum lycopersicum LA925: 100
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGATTCAGCTGAACACTTCTGACC
Enzymes
All possible enzymes for pennellii and and lycopersicum: DraI
  
Accessions and product sizes
Solanum lycopersicum LA925: 200
Solanum pennellii LA716: 200
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text

Genomic location of C2_At5g62530  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D9159 marker 9159
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)