SGN Marker SSR244

SGN-M917

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 60 High: 45
Repeat motif: TA   Repeat number: 14
Repeat motif:    Repeat number:
Forward primer: TTGTGTTTGATCTGCCTTGG
Reverse primer: ACCCTGGCTCTACCCTCACT
Predicted size: 201
Derivations 
This marker was derived from EST read SGN-E42563
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39197)
Chromosome
8
Position
7.00 cM
Confidence
I
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 99
Forward primer (5'-3')
TTGTGTTTGATCTGCCTTGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCCTGGCTCTACCCTCACT
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 193+193
Approximate temperature
55°C
  
Overgo hybridization and physical mapping 
SSR244 was used as an overgo probe on plate 1 [well G2]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TCACGAGCTACCAAGTCTCTGTTC
B sequence
CACGAGAACTTGAAGTGAACAGAG
AB sequence
TCACGAGCTACCAAGTCTCTGTTCACTTCA
Marker sequence
TCAGATTTGTAGATCTGCTTCACGAGCTACCAAGTCTCTGTTCACTTCAA
GTTCTCGTGCTTTTTCCGGTAAAATTTTCGTTCCATTCCTCCTTAAATCT
CAAATGTTTCTTCCTTCTTCGCTTCCTCGTCTAATCTTTCATGTATATAT
TTATATATAATCAATTTATGTGTGTGTGGTGCATAGACTGATTTTCAATC
TATGTGCATTTCCAGCTTGGTTTATTTTTGATGTGTTTGTGTGCAGACTG
ATTTCAAAATTCTCGTGCATTATCGAGCTCGGTTTGTGTAATTGTGCGTT
GATTTTGAAACCTTAGATGTTTATTTTCTATTATATATAACTGCCTTTAG
CACCATTGATGTGCTTGATCTATCTATGTGTGTGTGGTCTCAGACTGATT
TCAGTGCTTGTGCATCTTTGAACTCAGTGTGGTTGTGTTTGATCTGCCTT
GGGGGAAGCACTGAGCTTTTCGATCATGATATATATTTCTAGAAAAAATT
TATTAACCTATATATATATGTGTCTGTTCACAGACTGATTTCAATTTTCG
TGTATCTTCGAGCTTGGGTTATATATATATATATATATATATATATACGT
GTGTGTGAGATCTAGTGAGGGTAGAGCCAGGGTAGTGTAATTCGTTGAAA
AAATACTACACTAATCATAAACCGAACCGATTCAATGTCTGTATATACTC
GATCAGCCTCTATTTCTG
Genomic location of SSR244  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D917 marker 917
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)