SGN Marker C2_At5g63220

SGN-M9172
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle304224 (SGN)
123007 (CGN)
---
Capsicum annuumMultipleSGN-U197312---
Lycopersicon CombinedSingleSGN-U217754---
Solanum tuberosumMultipleSGN-U261081---
ArabidopsisSingleAt5g63220 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38913)
Chromosome
8
Position
18.50 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 40015
Forward primer (5'-3')
TGCAGTCGAAGCATCTTGACTTTC
Accessions and product sizes
Solanum lycopersicum TA209
750
Solanum pennellii TA56
750
Approximate temperature
55°C
Reverse primer (5'-3')
AAGAGAGGTAAAGCATCTCTCTGC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
250+400
Solanum lycopersicum TA209
750
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 27648)
Chromosome
5
Position
25.37 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 12093
Forward primer (5'-3')
TGCAGTCGAAGCATCTTGACTTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGAGAGGTAAAGCATCTCTCTGC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 450
Approximate temperature
55°C
  
PCR data   Exp. ID 12094
Forward primer (5'-3')
TGCAGTCGAAGCATCTTGACTTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGAGAGGTAAAGCATCTCTCTGC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 450
Approximate temperature
55°C
  
PCR data   Exp. ID 12095
Forward primer (5'-3')
TGCAGTCGAAGCATCTTGACTTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGAGAGGTAAAGCATCTCTCTGC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 450
Approximate temperature
55°C
  
PCR data   Exp. ID 12096
Forward primer (5'-3')
TGCAGTCGAAGCATCTTGACTTTC
Digested band sizes (using HinfI)
Solanum lycopersicum LA925: 450
Solanum pennellii LA716: 180+220
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGAGAGGTAAAGCATCTCTCTGC
Enzymes
All possible enzymes for pennellii and and lycopersicum: MspI, TaqI, HaeIII, HinfI, DpnII
All possible enzymes for lycopersicum and pimpinellifolium: HaeIII, DpnII
  
Accessions and product sizes
Solanum lycopersicum LA925: 450
Solanum pennellii LA716: 450
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Genomic location of C2_At5g63220  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D9172 marker 9172
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)