SGN Marker C2_At5g63460

SGN-M9178
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle309353 (SGN)
128297 (CGN)
---
Capsicum annuumSingleSGN-U201136---
Lycopersicon CombinedSingleSGN-U230532---
Solanum tuberosumSingleSGN-U247572---
ArabidopsisSingleAt5g63460 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38915)
Chromosome
3
Position
83.30 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 40017
Forward primer (5'-3')
TTCTCGCGGCCTTTTCTCCTC
Accessions and product sizes
Solanum lycopersicum TA209
250
Solanum pennellii TA56
250
Approximate temperature
55°C
Reverse primer (5'-3')
TCGTGATCGCAAACATATACTCGC
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
250
Solanum pennellii TA56
80+120
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 27654)
Chromosome
5
Position
25.43 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 12101
Forward primer (5'-3')
TTCTCGCGGCCTTTTCTCCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCGTGATCGCAAACATATACTCGC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1100
Approximate temperature
55°C
  
PCR data   Exp. ID 12102
Forward primer (5'-3')
TTCTCGCGGCCTTTTCTCCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCGTGATCGCAAACATATACTCGC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1100
Approximate temperature
55°C
  
PCR data   Exp. ID 12103
Forward primer (5'-3')
TTCTCGCGGCCTTTTCTCCTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCGTGATCGCAAACATATACTCGC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1100
Approximate temperature
55°C
  
PCR data   Exp. ID 12104
Forward primer (5'-3')
TTCTCGCGGCCTTTTCTCCTC
Digested band sizes (using HinfI)
Solanum lycopersicum LA925: 650
Solanum pennellii LA716: 850
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCGTGATCGCAAACATATACTCGC
Enzymes
All possible enzymes for pennellii and and lycopersicum: AluI, RsaI, HinfI, DpnII
  
Accessions and product sizes
Solanum lycopersicum LA925: 1100
Solanum pennellii LA716: 1100
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text

Genomic location of C2_At5g63460  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D9178 marker 9178
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)