Notice: Due to a server issue, SGN was unavailable earlier today. We apologize for any inconvenience.

SGN Marker C2_At5g67530

SGN-M9241
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle303258 (SGN)
124753 (CGN)
---
Capsicum annuumSingleSGN-U205011---
Lycopersicon CombinedSingleSGN-U226313---
Solanum tuberosumSingleSGN-U254295---
ArabidopsisSingleAt5g67530 on TAIR---
Mapped locations  
Map: Pepper-COSII   
Map version
58 (location: 41553)
Chromosome
2
Position
109.70 cM
Confidence
I
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43529
Forward primer (5'-3')
ACGGGAAATGTTTTCTGTTATGAG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TCAGTGAGAAGCTCCTTCCAGTTC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38924)
Chromosome
2
Position
127.00 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 40026
Forward primer (5'-3')
ACGGGAAATGTTTTCTGTTATGAG
Accessions and product sizes
Solanum lycopersicum TA209
350
Solanum pennellii TA56
350
Approximate temperature
55°C
Reverse primer (5'-3')
TCAGTGAGAAGCTCCTTCCAGTTC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
180
Solanum lycopersicum TA209
200
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 27717)
Chromosome
5
Position
26.96 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 12142
Forward primer (5'-3')
ACGGGAAATGTTTTCTGTTATGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAGTGAGAAGCTCCTTCCAGTTC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 150
Approximate temperature
55°C
  
PCR data   Exp. ID 12143
Forward primer (5'-3')
ACGGGAAATGTTTTCTGTTATGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAGTGAGAAGCTCCTTCCAGTTC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 150
Approximate temperature
55°C
  
PCR data   Exp. ID 12144
Forward primer (5'-3')
ACGGGAAATGTTTTCTGTTATGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAGTGAGAAGCTCCTTCCAGTTC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 150
Approximate temperature
55°C
  
PCR data   Exp. ID 12145
Forward primer (5'-3')
ACGGGAAATGTTTTCTGTTATGAG
Digested band sizes (using MspI)
Solanum lycopersicum LA925: 150
Solanum pennellii LA716: 100
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAGTGAGAAGCTCCTTCCAGTTC
Enzymes
All possible enzymes for pennellii and and lycopersicum: MspI
  
Accessions and product sizes
Solanum pennellii LA716: 150
Solanum lycopersicum LA925: 150
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Genomic location of C2_At5g67530  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D9241 marker 9241
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)