SGN Marker TG67

SGN-M93

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1500
Vector
pUC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
TG67 image not available
Forward sequence
TGAAGAATCCAGAGCTTATAAATATGATTGCAGACTAAGTGTGTGCTTACCGTCAGAGCTTTTTTCTTGAGCTTGTTCATTACTGAAAAC
TGCTTGAGTCTTGCTTTAACAGTCTCACCCAATGAGACGTTTGGTGCTTTCTTTATATTATGTAACCAGGGATGCTCTGCACCACAAGAG
TCAAAGCCCCGGAAAAAAATACTTATCAGAGATAGATAGAGAGAGAGAGAGAGAGAGAGAGAGAGTAAAACAACGAATGAATAAAGTACA
ATATCTCAATATTCCACAAACATTACCAAGAACTTGATGAGCTGTGAGCCGTCGAGTTGGATCTGGATCAAGCATTTTCTTTACAAGATC
CTTTGCATTATCAGAAACTTTAGGCCATGGATCCCTCTTGAAATCAATCACAGAACGAATAATCGCTTGGGCTACTCCTTGTTCAGTCTC
TGCAAATATTCAGAGGAACTTAAGGGAAGTATCAAGAATATGTTAACATATTTATGCAAG
Reverse sequence
TCTATTTAGTCATTGTCCTTTTCTGCATCGACTATATAGTGGCCTGAATGACATTACAAAATATTTATGAGTTGGTAGGAATCTTTTTTT
CATATGTGAATCATGAATGTGTTCACAAATGATCAATCAGAGAGTGATTATTGTATTATGTGGTGTTGATAACTTTTGAACTTTTCTTCA
TTTGGTTTGTGTTTAACTGTTATCTGAAAGGCTTGGTTGGTGGTACTAAAGCTATTGGATTAGCAGAAAACTTTATACATGTTTATGGTC
ATGTTTCGCTCTCCAGTCCCCGTTTTTATTTGTCAAAGGTCAGTTCATATATTTCCAATGGTTTTGCAGATGTGTCACAGGCAAGGGGTA
ATGCATCGTGATCTCAAACCTGAGAATTTTCTTTTTGGTAACAAGAAAGAAACAGCTCCACTGAAGGCTATTGACTTTGGGTTGTCTGTT
TTCTTTAAACCTGGTAATGG
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1487092.3e-0650 (9.8% of RFLP seq)+
SGN-U1537781.5e-07108 (21.2% of RFLP seq)+
SGN-U1537789.4e-09114 (22.4% of RFLP seq)+
SGN-U1635584e-1463 (12.4% of RFLP seq)+
SGN-U1635581.3e-32106 (20.8% of RFLP seq)+
SGN-U1635597.3e-62119 (23.3% of RFLP seq)+
SGN-U1635591.5e-84157 (30.8% of RFLP seq)+
SGN-U1524543.3e-0536 (7.7% of RFLP seq)-
SGN-U1537788.4e-06105 (22.3% of RFLP seq)-
SGN-U1472103.4e-0837 (7.9% of RFLP seq)-
Mapped locations  
Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43350)
Chromosome
1
Position
17.10 cM
Confidence
uncalculated
Protocol
RFLP


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8058)
Chromosome
1
Position
7.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 8059)
Chromosome
1
Position
24.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPIMP 2001
Overgo hybridization and physical mapping 
TG67 was used as an overgo probe on plate 3 [well B6]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P160B12,   P113E16,   P009I12,   P271N11,   P239L02,   P315C01,   P236O08,   P169M23,   P245O06,   P299K05,   P253A12,   P144C08,   P106L09,   P245N04,   P179J06,   P162I22

 Overgo Sequences

A sequence
ATGTAACCAGGGATGCTCTGCACC
B sequence
GGGCTTTGACTCTTGTGGTGCAGA
AB sequence
ATGTAACCAGGGATGCTCTGCACCACAAGA
Marker sequence
TGAAGAATCCAGAGCTTATAAATATGATTGCAGACTAAGTGTGTGCTTAC
CGTCAGAGCTTTTTTCTTGAGCTTGTTCATTACTGAAAACTGCTTGAGTC
TTGCTTTAACAGTCTCACCCAATGAGACGTTTGGTGCTTTCTTTATATTA
TGTAACCAGGGATGCTCTGCACCACAAGAGTCAAAGCCCCGGAAAAAAAT
ACTTATCAGAGATAGATAGAGAGAGAGAGAGAGAGAGAGAGAGAGTAAAA
CAACGAATGAATAAAGTACAATATCTCAATATTCCACAAACATTACCAAG
AACTTGATGAGCTGTGAGCCGTCGAGTTGGATCTGGATCAAGCATTTTCT
TTACAAGATCCTTTGCATTATCAGAAACTTTAGGCCATGGATCCCTCTTG
AAATCAATCACAGAACGAATAATCGCTTGGGCTACTCCTTGTTCAGTCTC
TGCAAATATTCAGAGGAACTTAAGGGAAGTATCAAGAATATGTTAACATA
TTTATGCAAG
Genomic location of TG67  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D93 marker 93
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)