SGN Marker SSR266

SGN-M939

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 47.619 High: 47.619
Repeat motif: TA   Repeat number: 5
Repeat motif: TGTA   Repeat number: 2
Repeat motif: TA   Repeat number: 10
Repeat motif:    Repeat number:
Forward primer: CAAGTTCACCTCATTTGACCC
Reverse primer: TGTGTGAGCACTAAAGGACGA
Predicted size: 200
Derivations 
This marker was derived from EST read SGN-E43376
Mapped locations  
Map: Sun1642 x LA1589   
Map version
85 (location: 43788)
Chromosome
1
Position
23.80 cM
Confidence
uncalculated
Protocol
SSR


Sun1642 x LA1589

PCR data   Exp. ID 44795
Forward primer (5'-3')
CAAGTTCACCTCATTTGACCC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TGTGTGAGCACTAAAGGACGA
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43248)
Chromosome
1
Position
32.80 cM
Confidence
uncalculated
Protocol
SSR


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

PCR data   Exp. ID 44609
Forward primer (5'-3')
CAAGTTCACCTCATTTGACCC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TGTGTGAGCACTAAAGGACGA
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40783)
Chromosome
1
Position
41.00 cM
Confidence
uncalculated
Protocol
SSR


Tomato-EXPIMP 2008

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39200)
Chromosome
1
Position
32.70 cM
Confidence
I
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 31949
Forward primer (5'-3')
CAAGTTCACCTCATTTGACCC
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
TGTGTGAGCACTAAAGGACGA
Enzymes
  
Accessions and product sizes
Approximate temperature
47°C
  
Overgo hybridization and physical mapping 
SSR266 was used as an overgo probe on plate 11 [well B2]

Plausible BAC Matches:   P030P02,   P148G14,   P054N01,   P005D24

 Overgo Sequences

A sequence
GCTAACTAGGGTTATGTGTTAAGG
B sequence
CTTGCTTCGATACCCACCTTAACA
AB sequence
GCTAACTAGGGTTATGTGTTAAGGTGGGTA
Marker sequence
CTTTGTTACAACAAACGAACGTTATGATTTCCTTAGTGTACTATTTCAAA
ACTATTGAAGATTAAGCATTTTGGATATCAATTAGGTCTTTTAAGGATTG
TAATGTAGGCTAAGGGACAAGTAGGAACATATCATGAATAAGAGTAGTGA
TTGTTTTCCCAAGCGCTTTAGTGCTAACATTGCAATTTCAACTGCTCCTA
TGATAATCACATCTTATGTTCTTTTCTTTGGAACCATTTTGGTCCCTTAT
ACAAGTTCACCTCATTTGACCCCTTTTCCTTCTCAAATAATCTAGTTCAC
CCCCACACTTTTATTTTCGTAAAAATCAGATATGTTCCTCTATTTATATA
TATATATATATATATGTATGTATATATATATATTATTTCTATTTTTTTAA
AACGTTTCTATTGGGGTACCCACTTAACTTTCGTCCTTTAGTGCTCACAC
AAAAATCATAGGATCATTTATATCAAAGTTCTAAGCCAAAGGAAAAATGG
TATAAACTTCGTAGTAGGCTACCAGAGAAATGGTTCAAGGCTTAAGGGGG
CTAACTAGGGTTATGTGTTAAGGTGGGTATCGAAGCAAGATAGAGCTTCC
AAAGAAATGCGTACATCACTTTCGAAATAACTACTCCTCTTA
Genomic location of SSR266  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D939 marker 939
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)