SGN Marker SSR270

SGN-M943

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 50 High: 50
Repeat motif: GAA   Repeat number: 5
Repeat motif: GGAGAA   Repeat number: 7
Repeat motif:    Repeat number:
Forward primer: AGCTCAAGGCTTCTGTTGGA
Reverse primer: AACCACCTCAGGCACTTCAT
Predicted size: 231
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 52837)
Chromosome
1
Position
89.61 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_1 MQTL_2_Late_blight_1
Potato meta-QTL consensus map

Map: Tomato-LXCHM 2007   
Map version
68 (location: 42991)
Chromosome
1
Position
23.50 cM
Confidence
uncalculated
Protocol
SSR


Tomato-LXCHM 2007

PCR data   Exp. ID 43991
Forward primer (5'-3')
AGCTCAAGGCTTCTGTTGGA
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
AACCACCTCAGGCACTTCAT
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39202)
Chromosome
1
Position
46.00 cM
Confidence
CF(LOD3)
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 7
Forward primer (5'-3')
AGCTCAAGGCTTCTGTTGGA
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AACCACCTCAGGCACTTCAT
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 244+255
Solanum lycopersicum LA925: 244+244
Approximate temperature
50°C
  
Genomic location of SSR270  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D943 marker 943
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)