SGN Marker TG69

SGN-M95

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
5300
Vector
pUC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
Forward sequence
GAGATTCTTTCTTTTGAAACTTTTGGATGTAAGTATTACTAGAATACTCCTTGTGTATTCTTGTCTATAATACAAGTTACCTTTCTAAAA
AAATTATAAGATTACTGAAAGTGAAAGGATATCAAGAGAAACACACCTGATAGTATCTTCCATCTAGTTTCTTAATGCCATAACCCAGTT
GAACAGTTCCAAATGACTTTAAATCTGTAAGGACCCCATTTTTTCGATAGACATGCTTCCCAACCTTTGCAATGAGGTCCATCATAGCCT
CCTTCTTTACATGGGGTTTCAGTAACAGCATACAGTCATATAGAGGCATCTTTTGTCTTCTCTTGATTCAACCAACTTCAGGAATCACAG
AACTGAATTACGTCAAATCTTGGAAAATGAAAAACTACGACAAAATGCACACTGCAGGTAATCAAAGCCAACTCAACCAAGAAGTTCCCT
CATTGAAGGAATCATACTCCAAAATGTTGTAACACATTGAGAAATTTTCTTAG
Reverse sequence
ATACAATCTATTTGGGGATTAAGCTGATAAATGTATCATATAACATATACACACATCAAAGAAGTTGGCGTATACTGAAACACGCATTTC
CAGCACTGCTGAGTTTTTAGCAAAAACAGTTTTGGCAAAATTAAAGTTCTCAAGAGTTTTTAAGAACCATTGCACAATACTTTTTTGAAA
ATTGAGTTTCTAACACTTTCTCCAAAACCTCAACAACTGAGTTCCCAAAAAACTCAAACACCAAAATTCTTCCATACTGTCAAAAGCTGA
ATCAAAATTCAGCTAAACAAATTCCATATATATACATAAAACGGCAAGAGGTAGGACCTGGTGAAGTATAGGGAAGTCGGAACGGGTGAT
ATGCCCTAGCGAACCGGGTCCAAGTTTCGGGCCTTCTACTAATGGAGCTGAAGCTGATGCTGATGCTGAAGCTGAAATATGTAACCGTCG
GTAACTCCATGGGAACGAATTGGAGC
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1658196.7e-1959 (11.7% of RFLP seq)+
SGN-U1623893.1e-67212 (42.1% of RFLP seq)+
SGN-U1487334e-119215 (42.7% of RFLP seq)+
SGN-U1544975.3e-78150 (31.5% of RFLP seq)-
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 53377)
Chromosome
5
Position
44.06 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_5 MQTL_1_Maturity_5 MQTL_2_Late_blight_5
Potato meta-QTL consensus map

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 50421)
Chromosome
5
Position
63.92 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 48353)
Chromosome
5
Position
128.45 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40125)
Chromosome
5
Position
111.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXHIR 1997   
Map version
32 (location: 8067)
Chromosome
5
Position
113.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXHIR 1997

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8068)
Chromosome
5
Position
87.50 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 8072)
Chromosome
5
Position
52.30 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992
Overgo hybridization and physical mapping 
TG69 was used as an overgo probe on plate 5 [well F3]

Plausible BAC Matches:   P160D23,   P172K24,   P212A18,   P311G17,   P299E20,   P149P03,   P104F21,   P261N11,   P170J13,   P006N20,   P285F14,   P311A16,   P200D06,   P108A18,   P192G24,   P006A24

 Overgo Sequences

A sequence
TGCTTCCCAACCTTTGCAATGAGG
B sequence
AGGAGGCTATGATGGACCTCATTG
AB sequence
TGCTTCCCAACCTTTGCAATGAGGTCCATC
Marker sequence
GAGATTCTTTCTTTTGAAACTTTTGGATGTAAGTATTACTAGAATACTCC
TTGTGTATTCTTGTCTATAATACAAGTTACCTTTCTAAAAAAATTATAAG
ATTACTGAAAGTGAAAGGATATCAAGAGAAACACACCTGATAGTATCTTC
CATCTAGTTTCTTAATGCCATAACCCAGTTGAACAGTTCCAAATGACTTT
AAATCTGTAAGGACCCCATTTTTTCGATAGACATGCTTCCCAACCTTTGC
AATGAGGTCCATCATAGCCTCCTTCTTTACATGGGGTTTCAGTAACAGCA
TACAGTCATATAGAGGCATCTTTTGTCTTCTCTTGATTCAACCAACTTCA
GGAATCACAGAACTGAATTACGTCAAATCTTGGAAAATGAAAAACTACGA
CAAAATGCACACTGCAGGTAATCAAAGCCAACTCAACCAAGAAGTTCCCT
CATTGAAGGAATCATACTCCAAAATGTTGTAACACATTGAGAAATTTTCT
TAG
Genomic location of TG69  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D95 marker 95
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)