Sol Genomics Network

SGN Marker C2_At5g07910

SGN-M9516
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

Synonyms

None

Locus associations

None

Orthologs in this COSII group

Species	Copies	Sequence ID	CDS/Edited sequence	Peptide sequence	Predicted introns
Coffee	Single	306959 (SGN) 131716 (CGN)	-	-	-
Solanum tuberosum	Single	SGN-U254639	-	-	-
Arabidopsis	Single	At5g07910 on TAIR	-	-	-

Mapped locations

Map: Tomato-EXPEN 2000
Map version 52 (location: 38757)
Chromosome 12
Position 59.50 cM
Confidence I
Protocol CAPS
Subscript A

Tomato-EXPEN 2000

Map: Tomato-EXPEN 2000
Map version 52 (location: 38758)
Chromosome 3
Position 112.00 cM
Confidence I(LOD2)
Protocol CAPS
Subscript B

Tomato-EXPEN 2000

Map: Arabidopsis COSII
Map version 44 (location: 27064)
Chromosome 5
Position 2.52 MB
Confidence uncalculated
Protocol CAPS

Arabidopsis COSII

Other PCR data

PCR data Exp. ID 32569
Forward primer (5'-3') TGCTTTACGCGACTCCAAATTG		Mg⁺² concentration 1.5mM
Reverse primer (5'-3') TCCAGGGAAATAACTTCATCAGG	Enzymes
Accessions and product sizes Solanum pennellii LA716: 920+1350	Approximate temperature 55°C

PCR data Exp. ID 32570
Forward primer (5'-3') TGCTTTACGCGACTCCAAATTG		Mg⁺² concentration 1.5mM
Reverse primer (5'-3') TCCAGGGAAATAACTTCATCAGG	Enzymes
Accessions and product sizes Solanum lycopersicum LA925: 920+1350	Approximate temperature 55°C

PCR data Exp. ID 32571
Forward primer (5'-3') TGCTTTACGCGACTCCAAATTG		Mg⁺² concentration 1.5mM
Reverse primer (5'-3') TCCAGGGAAATAACTTCATCAGG	Enzymes
Accessions and product sizes Solanum pimpinellifolium LA1589: 920+1350	Approximate temperature 55°C

PCR data Exp. ID 32573
Forward primer (5'-3') TGCTTTACGCGACTCCAAATTG	Digested band sizes (using DraI) Solanum lycopersicum LA925: 350+530 Solanum pennellii LA716: 250+640	Mg⁺² concentration 1.5mM
Reverse primer (5'-3') TCCAGGGAAATAACTTCATCAGG	Enzymes All possible enzymes for pennellii and and lycopersicum: AluI, DraI, HaeIII, HinfI; DpnII
Accessions and product sizes Solanum lycopersicum LA925: 920+1350 Solanum pennellii LA716: 920+1350	Approximate temperature 55°C

PCR data Exp. ID 32650
Forward primer (5'-3') TGCTTTACGCGACTCCAAATTG		Mg⁺² concentration 1.5mM
Reverse primer (5'-3') TCCAGGGAAATAACTTCATCAGG	Enzymes
Accessions and product sizes Solanum lycopersicum LA925: 1300	Approximate temperature 55°C

PCR data Exp. ID 33181
Forward primer (5'-3') TGCTTTACGCGACTCCAAATTG		Mg⁺² concentration 1.5mM
Reverse primer (5'-3') TCCAGGGAAATAACTTCATCAGG	Enzymes
Accessions and product sizes Solanum pimpinellifolium LA1589: 1300	Approximate temperature 55°C

PCR data Exp. ID 33182
Forward primer (5'-3') TGCTTTACGCGACTCCAAATTG		Mg⁺² concentration 1.5mM
Reverse primer (5'-3') TCCAGGGAAATAACTTCATCAGG	Enzymes
Accessions and product sizes Solanum pennellii LA716: 1300	Approximate temperature 55°C

PCR data Exp. ID 32572
Forward primer (5'-3') TGCTTTACGCGACTCCAAATTG	Digested band sizes (using DraI) Solanum lycopersicum LA925: 1350 Solanum pennellii LA716: 950	Mg⁺² concentration 1.5mM
Reverse primer (5'-3') TCCAGGGAAATAACTTCATCAGG	Enzymes All possible enzymes for pennellii and and lycopersicum: AluI, DraI, HaeIII, HinfI; DpnII
Accessions and product sizes Solanum lycopersicum LA925: 920+1350 Solanum pennellii LA716: 920+1350	Approximate temperature 55°C

PCR data Exp. ID 32572
Forward primer (5'-3') TGCTTTACGCGACTCCAAATTG	Digested band sizes (using DraI) Solanum lycopersicum LA925: 1350 Solanum pennellii LA716: 950	Mg⁺² concentration 1.5mM
Reverse primer (5'-3') TCCAGGGAAATAACTTCATCAGG	Enzymes All possible enzymes for pennellii and and lycopersicum: AluI, DraI, HaeIII, HinfI; DpnII
Accessions and product sizes Solanum pennellii LA716: 920+1350 Solanum lycopersicum LA925: 920+1350	Approximate temperature 55°C

Universal primers for Asterid species

No additional PCR data found.

Other COSII sequence data

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text

Related Markers

Related Genotyped Markers: These markers have been genotyped and share a name with this marker

Genomic location of C2_At5g07910

%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D9516 marker 9516

User comments

Please wait, checking for comments. (If comments do not show up, access them here)

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL:

SGN is supported by , and hosted at
Cite SGN using | Disclaimer