SGN Marker C2_At5g07910

SGN-M9516
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle306959 (SGN)
131716 (CGN)
---
Solanum tuberosumSingleSGN-U254639---
ArabidopsisSingleAt5g07910 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38757)
Chromosome
12
Position
59.50 cM
Confidence
I
Protocol
CAPS
Subscript
A


Tomato-EXPEN 2000

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38758)
Chromosome
3
Position
112.00 cM
Confidence
I(LOD2)
Protocol
CAPS
Subscript
B


Tomato-EXPEN 2000

Map: Arabidopsis COSII   
Map version
44 (location: 27064)
Chromosome
5
Position
2.52 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 32569
Forward primer (5'-3')
TGCTTTACGCGACTCCAAATTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAGGGAAATAACTTCATCAGG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 920+1350
Approximate temperature
55°C
  
PCR data   Exp. ID 32570
Forward primer (5'-3')
TGCTTTACGCGACTCCAAATTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAGGGAAATAACTTCATCAGG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 920+1350
Approximate temperature
55°C
  
PCR data   Exp. ID 32571
Forward primer (5'-3')
TGCTTTACGCGACTCCAAATTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAGGGAAATAACTTCATCAGG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 920+1350
Approximate temperature
55°C
  
PCR data   Exp. ID 32573
Forward primer (5'-3')
TGCTTTACGCGACTCCAAATTG
Digested band sizes (using DraI)
Solanum pennellii LA716: 250+640
Solanum lycopersicum LA925: 350+530
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAGGGAAATAACTTCATCAGG
Enzymes
All possible enzymes for pennellii and and lycopersicum: AluI, DraI, HaeIII, HinfI; DpnII
  
Accessions and product sizes
Solanum lycopersicum LA925: 920+1350
Solanum pennellii LA716: 920+1350
Approximate temperature
55°C
  
PCR data   Exp. ID 32650
Forward primer (5'-3')
TGCTTTACGCGACTCCAAATTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAGGGAAATAACTTCATCAGG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 33181
Forward primer (5'-3')
TGCTTTACGCGACTCCAAATTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAGGGAAATAACTTCATCAGG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 33182
Forward primer (5'-3')
TGCTTTACGCGACTCCAAATTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAGGGAAATAACTTCATCAGG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 32572
Forward primer (5'-3')
TGCTTTACGCGACTCCAAATTG
Digested band sizes (using DraI)
Solanum pennellii LA716: 950
Solanum lycopersicum LA925: 1350
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAGGGAAATAACTTCATCAGG
Enzymes
All possible enzymes for pennellii and and lycopersicum: AluI, DraI, HaeIII, HinfI; DpnII
  
Accessions and product sizes
Solanum lycopersicum LA925: 920+1350
Solanum pennellii LA716: 920+1350
Approximate temperature
55°C
  
PCR data   Exp. ID 32572
Forward primer (5'-3')
TGCTTTACGCGACTCCAAATTG
Digested band sizes (using DraI)
Solanum lycopersicum LA925: 1350
Solanum pennellii LA716: 950
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCAGGGAAATAACTTCATCAGG
Enzymes
All possible enzymes for pennellii and and lycopersicum: AluI, DraI, HaeIII, HinfI; DpnII
  
Accessions and product sizes
Solanum lycopersicum LA925: 920+1350
Solanum pennellii LA716: 920+1350
Approximate temperature
55°C
  
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text

Genomic location of C2_At5g07910  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D9516 marker 9516
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)