SGN Marker U213330

SGN-M9533

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40198)
Chromosome
1
Position
49.00 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 14037
Forward primer (5'-3')
TCATCATGATCAAGCCTGATGGTGTC
Digested band sizes (using HinfI)
Solanum lycopersicum LA925: 280
Solanum pennellii LA716: 190
Mg+2 concentration
Unknown
Reverse primer (5'-3')
AGAGAATCCTTTCTTCTCAAATCTGC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 280
Solanum pennellii LA716: 280
Approximate temperature
55°C
  
PCR data   Exp. ID 14037
Forward primer (5'-3')
TCATCATGATCAAGCCTGATGGTGTC
Digested band sizes (using HinfI)
Solanum lycopersicum LA925: 280
Solanum pennellii LA716: 190
Mg+2 concentration
Unknown
Reverse primer (5'-3')
AGAGAATCCTTTCTTCTCAAATCTGC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 280
Solanum lycopersicum LA925: 280
Approximate temperature
55°C
  
Unigene blast matches for primers 
Genomic location of U213330  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D9533 marker 9533
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)