Notice: The FTP site is available again. We apologize for any inconvenience.

SGN Marker U223116

SGN-M9543

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40225)
Chromosome
1
Position
91.70 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 14052
Forward primer (5'-3')
TCACTTCAATCTTCACTTCCTCCTCC
Digested band sizes (using DpnII)
Solanum pennellii LA716: 850
Solanum lycopersicum LA925: 1000
Mg+2 concentration
Unknown
Reverse primer (5'-3')
TGTCCAGTTTCCTTAAACTTCACATTC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1000
Solanum lycopersicum LA925: 1000
Approximate temperature
53°C
  
PCR data   Exp. ID 14052
Forward primer (5'-3')
TCACTTCAATCTTCACTTCCTCCTCC
Digested band sizes (using DpnII)
Solanum lycopersicum LA925: 1000
Solanum pennellii LA716: 850
Mg+2 concentration
Unknown
Reverse primer (5'-3')
TGTCCAGTTTCCTTAAACTTCACATTC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1000
Solanum lycopersicum LA925: 1000
Approximate temperature
53°C
  
Unigene blast matches for primers 
Genomic location of U223116  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D9543 marker 9543
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)