Notice: Due to a server issue, SGN was unavailable earlier today. We apologize for any inconvenience.

SGN Marker U242881

SGN-M9549

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40250)
Chromosome
7
Position
29.50 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 14061
Forward primer (5'-3')
TCAATGCAAAGCTTTCTGACTTTGG
Digested band sizes (using TaqI)
Solanum pennellii LA716: 550
Solanum lycopersicum LA925: 650
Mg+2 concentration
Unknown
Reverse primer (5'-3')
TAAACATCACTTCTTGCTGTTAAATGTC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 580+750
Solanum lycopersicum LA925: 580+750
Approximate temperature
55°C
  
PCR data   Exp. ID 14061
Forward primer (5'-3')
TCAATGCAAAGCTTTCTGACTTTGG
Digested band sizes (using TaqI)
Solanum lycopersicum LA925: 650
Solanum pennellii LA716: 550
Mg+2 concentration
Unknown
Reverse primer (5'-3')
TAAACATCACTTCTTGCTGTTAAATGTC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 580+750
Solanum pennellii LA716: 580+750
Approximate temperature
55°C
  
Genomic location of U242881  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D9549 marker 9549
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)