SGN Marker U213813

SGN-M9559

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from SGN unigene SGN-U213813
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40201)
Chromosome
1
Position
46.70 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 35639
Forward primer (5'-3')
CGCGGTCTAAGAGGTTCTTG
Digested band sizes (using TaqI)
Solanum lycopersicum LA925: 100+125
Solanum pennellii LA716: 125+225
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCACCTTGGGTAAGGACAGC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 350
Solanum lycopersicum LA925: 350
Approximate temperature
55°C
  
Genomic location of U213813  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D9559 marker 9559
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)