SGN Marker U231875

SGN-M9591

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from SGN unigene SGN-U231875
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40240)
Chromosome
3
Position
72.50 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 35652
Forward primer (5'-3')
TCGCTAACGAGTCTGGTCAA
Digested band sizes (using MspI)
Solanum lycopersicum LA925: 300
Solanum pennellii LA716: 350
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
CGACAGTTCAAATCAAAAGCTG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 350
Solanum pennellii LA716: 350
Approximate temperature
53°C
  
Genomic location of U231875  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D9591 marker 9591
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)