SGN Marker U222597

SGN-M9593

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from SGN unigene SGN-U222597
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40223)
Chromosome
3
Position
72.60 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 35645
Forward primer (5'-3')
CATTATTTTCACCTACGGAACACTC
Digested band sizes (using TaqI)
Solanum pennellii LA716: 100+350
Solanum lycopersicum LA925: 100+150
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
GTTAAATGCTGTGGCCTATCTTTAC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 450
Solanum lycopersicum LA925: 450
Approximate temperature
55°C
  
Genomic location of U222597  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D9593 marker 9593
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)