SGN Marker SSR288

SGN-M961

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 55 High: 45
Repeat motif: TGA   Repeat number: 7
Repeat motif:    Repeat number:
Forward primer: TCGTGGGAATTTGTTAACCC
Reverse primer: TCTTCATCGTCCTCCTCCTG
Predicted size: 275
Mapped locations  
Map: Sun1642 x LA1589   
Map version
85 (location: 43791)
Chromosome
1
Position
132.80 cM
Confidence
uncalculated
Protocol
SSR


Sun1642 x LA1589

PCR data   Exp. ID 44799
Forward primer (5'-3')
TCGTGGGAATTTGTTAACCC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TCTTCATCGTCCTCCTCCTG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43251)
Chromosome
1
Position
135.00 cM
Confidence
uncalculated
Protocol
SSR


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

PCR data   Exp. ID 44613
Forward primer (5'-3')
TCGTGGGAATTTGTTAACCC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TCTTCATCGTCCTCCTCCTG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40786)
Chromosome
1
Position
148.00 cM
Confidence
uncalculated
Protocol
SSR


Tomato-EXPIMP 2008

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39207)
Chromosome
1
Position
158.50 cM
Confidence
I(LOD2)
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 31853
Forward primer (5'-3')
TCGTGGGAATTTGTTAACCC
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
TCTTCATCGTCCTCCTCCTG
Enzymes
  
Accessions and product sizes
Approximate temperature
45°C
  
Genomic location of SSR288  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D961 marker 961
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)