SGN Marker TG151

SGN-M97

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1400
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG151 image not available
Forward sequence
TATATATGAATTTTGGGAAGTCTGGTTAGAAGAAAATCATGGATGTTTCACCAGGATAATAGTTAATCTTTCTCTTATGTACAATGCAGG
TGTTCATAAATATGTCCTTTTGGCATAGAAAGCCTGTTTTAAATAATTTTAACTGTGGTCTGGATTTCATGAAAGTAGGGGGTAAGGTCT
GTGTGCATCCAACCCTCCTCAGACCCCACTTGTGGGGTTATAATGGGTATGTTGTTGTTGACTGGATTTCATTGATGAGCCTCTTAAATT
AGAGGAATGAAATTCATATATTTTTGGGTGTATTTTTTTTTTTTTTTTGGATATGGTCACTTTCTTAACCCACTTGGGACTAATTTTATT
ACTTATAATGGAATTTCTTATCCTAAAAAGAGGGATT
Reverse sequence
AACTGTTCTCTGCAACTCTACCTCTTTTTCAGCAGTTTGGAGGTTTCTTTCTTTTTCCTGAATCACATATACCCTTGTCTTCCAACTCTT
TCTCCTTCTCAGCTAGGGTTCTTGACTGCCTCTCCAAATCATATTCCTTGTCAGTAATTAGGTCCTCCCGAGACTTAATATCCATATCTT
TCAATTCCCAAGCCCGCCTCTTGGTTTGAATCTCATCTTCCACCAATTTCCGTTTTGTTTCCAACTCTGCCTCGATAGAAGATATCTTAG
TTACCAATGTGGCCTCCTGATTAACCATAACCTGCTTACTTCCATCCTGCATGGTTCACCATAGTAAGAAGGTAAAGGGATCTAAAAGTA
AAGGATAAAATCATAGTTTTCTCTTGTGCCAAAACTTACAATCTCCTTGCTTTGTATTTTTCCCTGTAATAGCAGTAGCTCTTTCTCTTT
CTCGTAAAGTTCGTGTTCCC
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1729601.8e-3172 (15.3% of RFLP seq)-
Mapped locations  
Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53516)
Chromosome
2
Position
90.58 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2009

Map: Sun1642 x LA1589   
Map version
85 (location: 43836)
Chromosome
2
Position
44.80 cM
Confidence
uncalculated
Protocol
RFLP


Sun1642 x LA1589

Map: Yellow Stuffer x LA1589   
Map version
83 (location: 43585)
Chromosome
2
Position
87.10 cM
Confidence
uncalculated
Protocol
RFLP


Yellow Stuffer x LA1589

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43296)
Chromosome
2
Position
97.60 cM
Confidence
uncalculated
Protocol
RFLP


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40836)
Chromosome
2
Position
97.00 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2008

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39911)
Chromosome
2
Position
126.00 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8076)
Chromosome
2
Position
108.80 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 8078)
Chromosome
2
Position
93.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPIMP 2001
Other PCR data 
PCR data   Exp. ID 35615
Forward primer (5'-3')
TGAATTTTGGGAAGTCTGGTT
Digested band sizes (using RsaI)
Solanum pennellii LA716: 1200
Solanum lycopersicum LA925: 1500
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCAACTCTACCTCTTTTTCAGC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1500
Solanum pennellii LA716: 1500
Approximate temperature
55°C
  
PCR data   Exp. ID 35
Forward primer (5'-3')
Unknown
Digested band sizes (using RsaI)
Solanum pennellii LA716: 1200
Solanum lycopersicum LA925: 1500
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
Unknown
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1500
Solanum pennellii LA716: 1500
Approximate temperature
55°C
  
Overgo hybridization and physical mapping 
TG151 was used as an overgo probe on plate 6 [well F9]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GGGAAGTCTGGTTAGAAGAAAATC
B sequence
CTGGTGAAACATCCATGATTTTCT
AB sequence
GGGAAGTCTGGTTAGAAGAAAATCATGGAT
Marker sequence
TATATATGAATTTTGGGAAGTCTGGTTAGAAGAAAATCATGGATGTTTCA
CCAGGATAATAGTTAATCTTTCTCTTATGTACAATGCAGGTGTTCATAAA
TATGTCCTTTTGGCATAGAAAGCCTGTTTTAAATAATTTTAACTGTGGTC
TGGATTTCATGAAAGTAGGGGGTAAGGTCTGTGTGCATCCAACCCTCCTC
AGACCCCACTTGTGGGGTTATAATGGGTATGTTGTTGTTGACTGGATTTC
ATTGATGAGCCTCTTAAATTAGAGGAATGAAATTCATATATTTTTGGGTG
TATTTTTTTTTTTTTTTTGGATATGGTCACTTTCTTAACCCACTTGGGAC
TAATTTTATTACTTATAATGGAATTTCTTATCCTAAAAAGAGGGATT
Genomic location of TG151  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D97 marker 97
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)