Notice: Due to a server issue, SGN was unavailable earlier today. We apologize for any inconvenience.

SGN Marker SSR304

SGN-M977

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 50 High: 55
Repeat motif: CCA   Repeat number: 7
Repeat motif:    Repeat number:
Forward primer: TCCTCCGGTTGTTACTCCAC
Reverse primer: TTAGCACTTCCACCGATTCC
Predicted size: 186
Mapped locations  
Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53496)
Chromosome
7
Position
37.56 cM
Confidence
uncalculated
Protocol
SSR


Tomato-EXPIMP 2009

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39213)
Chromosome
7
Position
30.50 cM
Confidence
I
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 31859
Forward primer (5'-3')
TCCTCCGGTTGTTACTCCAC
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
TTAGCACTTCCACCGATTCC
Enzymes
  
Accessions and product sizes
Approximate temperature
55°C
  
Genomic location of SSR304  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D977 marker 977
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)