SGN Marker TG152

SGN-M98

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1900
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
TGAACTTGAAATATAAGTGTGACAGAATGCCAATAGAAATTAAGCTTACAAATCTTGTTATATTTGACCTGCTTTGTTGTTTTTGGAACA
TATGAACCCACAACAATAAGTCCACCATTTCTTTCTCTACTTATTCCAATATCATTTGGCAAAATTGGAGATTTTTGGATGATTCCAACT
CGAGTAGAAACAAAACTGGCAGCAGTACGGCACAAAAAGTGTTTTCCTTTTAGTTCTGCCTGCATATAGAAAGAAGCAAAGAAAATGAAA
ATCAACTTGCATCTCACCACATGAAAAAGAACTAATATCAAATGTAACAGGAATTCTATAAAACCTTTATCATTCCAGCGGCAAATACAG
TCATGTCTCTTTCACTAGCTGCATTGACTATACATGTTGAACCCTGTTACAGGAAATGCGATCAGGAGTGACAAATAATTAAGGTCGATT
TTTTGTAAGGAAGGGAAA
Reverse sequence
AACATTGATTCTGCTGCCAAGTCAGTGGAAAAAGCAGACTACACAGTGGTTCTGAGGGGTGATTCAACCTTACGAGGTCATTTCCCTGAG
GTGAGGATGGAGATAAGCTGACAGAAATCAAACCTTGTGTGGCCTTCTTTCCCCAACTTGTTTGGGATTGTGTTGTGGTTGTCGTCCTTT
CTTGACAGACTATTAAGATATCGTTGTATGCTATCTAGGAAGCAGATGCAGCTGTTTCTGTACTGGGTGAGATGGACGCATGGATTATCT
GCCCCTTTTTCTTACAAGGAGGCCGTTATACCATTGGAGATACACATTATGTTGCAGATTCTGATAGGTACCTTTCTAATCTAACATATA
TTAGTTGTTTGGACTTGCCGGAAAACACTTATTATGTCTTCTTGTCTTTAGGCTTGTTCCCGCAGGTGAAACAGAATTTGCTAAAGATGC
TGCATTTGGATACAAATCTTCCAACCTCCGAGAGGTC
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato QTL map   
Map version
137 (location: 53872)
Chromosome
3
Position
107.30 cM
Confidence
uncalculated
Protocol
RFLP

Titratable_acidity_ta3_1 Fruit_diameter_fd3_1 Elasticity_ela3_1 Fruit_weight_fw3_1 2_Phenylethanal_content_pea3_1 Carotene_content_car3_1 Sugar_content_suc3_1
Tomato QTL map

Map: Eggplant-COSII   
Map version
63 (location: 42408)
Chromosome
3
Position
136.80 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39912)
Chromosome
3
Position
139.40 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Eggplant-LXM 2002   
Map version
29 (location: 8080)
Chromosome
3
Position
147.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8079)
Chromosome
3
Position
102.60 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 8084)
Chromosome
3
Position
108.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPIMP 2001
Overgo hybridization and physical mapping 
TG152 was used as an overgo probe on plate 3 [well F12]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TCCAGCGGCAAATACAGTCATGTC
B sequence
TGCAGCTAGTGAAAGAGACATGAC
AB sequence
TCCAGCGGCAAATACAGTCATGTCTCTTTC
Marker sequence
TGAACTTGAAATATAAGTGTGACAGAATGCCAATAGAAATTAAGCTTACA
AATCTTGTTATATTTGACCTGCTTTGTTGTTTTTGGAACATATGAACCCA
CAACAATAAGTCCACCATTTCTTTCTCTACTTATTCCAATATCATTTGGC
AAAATTGGAGATTTTTGGATGATTCCAACTCGAGTAGAAACAAAACTGGC
AGCAGTACGGCACAAAAAGTGTTTTCCTTTTAGTTCTGCCTGCATATAGA
AAGAAGCAAAGAAAATGAAAATCAACTTGCATCTCACCACATGAAAAAGA
ACTAATATCAAATGTAACAGGAATTCTATAAAACCTTTATCATTCCAGCG
GCAAATACAGTCATGTCTCTTTCACTAGCTGCATTGACTATACATGTTGA
ACCCTGTTACAGGAAATGCGATCAGGAGTGACAAATAATTAAGGTCGATT
TTTTGTAAGGAAGGGAAA
Genomic location of TG152  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D98 marker 98
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)