SGN Marker SSR308

SGN-M981

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 50 High: 45
Repeat motif: TA   Repeat number: 12
Repeat motif:    Repeat number:
Forward primer: TTTCCCTGTTTCAGCCTTTG
Reverse primer: GGCACGAGAATTTAGCCACT
Predicted size: 293
Mapped locations  
Map: Sun1642 x LA1589   
Map version
85 (location: 43794)
Chromosome
1
Position
101.10 cM
Confidence
uncalculated
Protocol
SSR


Sun1642 x LA1589

PCR data   Exp. ID 44803
Forward primer (5'-3')
TTTCCCTGTTTCAGCCTTTG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
GGCACGAGAATTTAGCCACT
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43254)
Chromosome
1
Position
101.90 cM
Confidence
uncalculated
Protocol
SSR


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

PCR data   Exp. ID 44617
Forward primer (5'-3')
TTTCCCTGTTTCAGCCTTTG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
GGCACGAGAATTTAGCCACT
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40790)
Chromosome
1
Position
116.00 cM
Confidence
uncalculated
Protocol
SSR


Tomato-EXPIMP 2008

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39215)
Chromosome
1
Position
121.00 cM
Confidence
CF(LOD3)
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 15
Forward primer (5'-3')
TTTCCCTGTTTCAGCCTTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
GGCACGAGAATTTAGCCACT
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 293+300
Solanum pennellii LA716: 293+293
Approximate temperature
55°C
  
Genomic location of SSR308  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D981 marker 981
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)