SGN Marker SSR325

SGN-M998

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 41 High: 50
Repeat motif: TAA   Repeat number: 7
Repeat motif:    Repeat number:
Forward primer: CCATTGACAGCCCATTATCC
Reverse primer: TGATGTGAAAGAGTTGATGAGG
Predicted size: 132
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39222)
Chromosome
5
Position
18.50 cM
Confidence
I
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 32068
Forward primer (5'-3')
CCATTGACAGCCCATTATCC
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
TGATGTGAAAGAGTTGATGAGG
Enzymes
  
Accessions and product sizes
Approximate temperature
50°C
  
Genomic location of SSR325  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D998 marker 998
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)