Allele: 'e2187'

Allele details 
[New] [Edit] [Delete]

Locus nameLEAFLESS
Allele symbol e2187
Allele name e2187
Mode of inheritance recessive
Phenotype leafless seedlings lacked cotyledons, but after germination, a broad collar-like tissue surrounded the SAM, likely representing the vestigial cotyledons. As the seedlings matured, the miniature plant shoot appeared as an elongated pin. The bare lfs plant SAMs occasionally formed one to three simple leaves, with zero to three leaflets and entire margins with abnormal phyllotaxis. The naked meristems topping the elongated pin mutant shoots turned into a flower at about the same time as their WT siblings. The flowers were deformed, with sepals missing or small, petals nearly normal, stamens malformed and sterile and with two or more carpels, which rarely gave rise to parthenocarpic fruit (Capua and Eshed 2017).
Sequence/mutation GAAGATGCAATGAGAAGACTTAATCAA(G/T)AAACTGATGTTCCACTCCAAAACACT


Allele synonyms: [Add/remove]

Associated accessionsNone[Associate accession]  
Sequence annotations (0)None[Associate new genbank sequence] 
Literature annotationNone[associate new publication] 
User commentsNone[Add comment]