Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E1191797

Search information 
Request: 1191797Match: SGN-E1191797
Request From: Random SelectionMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C931068Clone name: NBMBL86
nocartOrdering Not Available
Library Name: Nb_MixTis1Organism: Nicotiana benthamiana

Tissue: abiotic and biotic stress-treated leaves, callus tissue and root tissue
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C931068 [NBMBL86] Trace: SGN-T922178 EST: SGN-E1191798 Direction: Unknown Facility: Unknown
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E1191797Length: 920 bp (920 bp untrimmed)
Status: Current VersionDirection: Unknown
>SGN-E1191797 [] (trimmed) CGATTTATCTCTTATACAATTTTCCGGCGATGTCCATGGCAAGAGTTGCCGCCGATGATAACACTTCTAACGCCGACGTTAGTCCCAGCAACGGC
GGTGTCGGAGTTGATACGTCACCGCTTCTCACCAATTCCCGTAGCCAGCGTTCGTTCCATCGCCGTCCGAGCCTCCGAGGAGCTGCCGGCTTTCT
ACGGCGCGCAAGTAGCCGCCGGTTAATGCGCGAGCCATCGATGCGAGTTCGCGAAGCTGCCGCTGAGCAAATCGAGGAGCGACAAAGCGACTGGG
CGTACTCAAAACCTATAGTGATATTAGATCTCATATGGAACTTAGCTTTTGTTATTGTAGCAATCTCTGTTCTTGTAATGAGCAAAAATGAGTGT
CCTTCTATGCCTTTAAGGCTTTGGATTATCGGATACGCTTTACAGTCTGTGCTTCACATGGTTTGTGTGTTCGTCGAATATAGACGCCGATGTCA
GCGGCGGAATTCCTCAAGCGGCAGTGGAAATTGGAATAATAGAGAAGTTTCGAACTTCAGTTCGGAAAGTGATGGAGGAGAATCTGGTGATTATT
TGCTGGAGAGGCGTCAAAACGAGGACGAAACTAGTGTTGCCAAGCATCTGGAGTCCGCAAACACCATGTTTTCTTTCATTTGGTGGATAATTGGG
TTCTATTGGGTATCTGCTGGTGGCCAAACTATGACCCGTGATGCACCTCAACTTTACTGGTTATCTCAAAACTAGGCTCTAGCGCTGCTTCATTT
CTTTTATTTGTACTTTATCTTTACGTGGTTTCTTTTCCAGGCTTTGTATCACGTTTCTGGCGTTTGATGTGTTCTTTGTTGTTATATGTGTTGCT
GTGGCTTGTGTAATCGGAATTGCTGTTTGCTGCTGTCTCCCATGTATCATCGCAATCTTATATGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E1191797] SGN-U515828 Nicotiana benthamiana Build 1 10 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T922177 [Download][View] Facility Assigned ID: CK289156
Submitter: None Sequencing Facility:
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: