EST details — SGN-E817834

Search information 
Request: 817834Match: SGN-E817834
Request From: Random SelectionMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C654100Clone name: TT-19_K13.abi
nocartOrdering Not Available
Library Name: TTOrganism: Nicotiana tabacum

Tissue: Trichomes and senescent leaf
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E817834Length: 625 bp (625 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E817834 [] (trimmed) cacacactttcttctccactcaaacaaacaattccttcttttgttcctttgatttcctataaacccaattcagatttttcaatttctttcacttc
ttcttcacaggtaaatcaacaatcccagctgagacaagttgctgcttctgtagcattcaatccttctgggaattttgacctctccctttatgatg
agcaagaaaatacagaagtagcacctccaccaatgcccccaacagaaggtagatacgaagttgttatagataatgacattattcaacgtcttgat
ttatccccatttcaaaatgcaactggattatcatcacccttatctgccaagccaaaggagtttctggaaaggacaattggttttacaatcaatta
caaaagagaagataaatatgatccaagggaattatcagaatttccagatatacgactatggttcattcggctagatgctacttatccatggctgc
cagttttattggattggagagctggagaacttgcacgttatgcagcaatgttggtaccccatcagatgagtatgaaaatgggggtagtattcaat
ccagaggcattggagttgtttgtgatgaataaagtgtttgtggtatattcttggt
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E817834] SGN-U450143 Nicotiana tabacum Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T654189 [Download] [View] Facility Assigned ID: TT-19_K13
Submitter: None Sequencing Facility: ATCsub
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: