EST details — SGN-E1087543

Search information 
Request: 1087543Match: SGN-E1087543
Request From: Random SelectionMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C814896Clone name: BY4054
nocartOrdering Not Available
Library Name: MAT001Organism: Nicotiana tabacum

Tissue: Unknown
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E1087543Length: 603 bp (603 bp untrimmed)
Status: Current VersionDirection: Unknown
>SGN-E1087543 [] (trimmed) AATTTGACCATTTTGTTGAAACAACAAGGTTGATAGTCAAGAAATTTTCTGTAGCCATATCTTCTTTTACCTTAGTACTAAAGGGTTCAAAGATG
GCCACAAATTGAGTATTGTTAAGATCAATCAATTTCTTCATCCTGTGAATGACTTTTTTGGACCTAACCCTCCTAATATTCCAGAAAAGAGAACT
AATCATCAGAACAATTGAGGGGTGGTATTCTCTTTTTGGCTCATTCTCATAGAAGGTTGAGTCTTGTTGTTGTGCCTTTTGTCACTTTTTGCTGG
TTTCACTTCTTCCTCTTCTTATCATATGTTGATATTCTTCATTGTGATTTTGAGAGTCAATCTCCTCATTTCTCAGCCTCTTTTTGAGCTGTACA
GAAGTTTCAACCATTTGAAGATTGTCAGCATTATCTTCTATCAACTTAAAGTTATCTCCATTTTCCTTGTTCCCGTATAGATCCACAACCAACTG
TAATCCAGGATGGTTCCTTATTTCAGTAGGAGCAGTAGATGAGTTAGAATCACAACAATATTGTTCAAGATTATGTTTCTCCTCGATCATGCCTT
CATGATTGCTATTCTGCCTGGGGTTGTTCTGAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E1087543] SGN-U481709 Nicotiana tabacum Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T818046 [Download][View] Facility Assigned ID: BP131940
Submitter: None Sequencing Facility:
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: