EST details — SGN-E1167795

Search information 
Request: 1167795Match: SGN-E1167795
Request From: Random SelectionMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C888757Clone name: nt002136007
nocartOrdering Not Available
Library Name: Nt_SLOrganism: Nicotiana tabacum

Tissue: seedling
Development Stage: five days after germination

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E1167795Length: 404 bp (404 bp untrimmed)
Status: Current VersionDirection: Unknown
>SGN-E1167795 [] (trimmed) ATAGCTCATTTCTGAGCTATAGCCTATTATACTGTCAAACCTTTTATCTGTCAACCTACACACATAATAAAATATCAAGTTAACCTACCATTGGC
ATTTGCTATGTATGAGAGTTAACTCAAGTATCCAAACAGAAATGTAAAACTACTATACATTCCGCGATATTCAGTATACAAGCTATGTCTAAAAA
TGAAATATCTTCAACTCTTCTCTTTTGTATTCATGCTCAACTTTCAAGTTACATGGACAGTATTAATCGTGTACCTCGCTACCTCGACCGCGAAA
GTACACCGGCAGCCTCGCCGGATCTTCGATGGAATTTGGCGGCACTGGAAAGCTCGTAATCAGACAAACCTCAAACTCAGTATCCAAATACCTCA
AATAAACTCCACATGAGTAAAAAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E1167795] SGN-U449197 Nicotiana tabacum Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T898325 [Download][View] Facility Assigned ID: AM822385
Submitter: None Sequencing Facility:
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: