Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

EST details — SGN-E812321

Search information 
Request: 812321Match: SGN-E812321
Request From: Random SelectionMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C641583Clone name: TL13.108L19F.060315T7.scf
nocartOrdering Not Available
Library Name: TL13Organism: Nicotiana tabacum

Tissue: Leaf
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E812321Length: 290 bp (906 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E812321 [] (trimmed) attacggccgggggaagagttgttagaggacctgctcctttgtccttggcattggctcatgctgatattgatgatgggaaggtggtgtttgtccc
atgggttgaaacagacttcagaactggtgaagatccatggtgggcttagatctccttatcactatattatcctcttgtatctttgttacataaag
cttatctcctttttatgaagtaaaaagaaatattcattttgagatgtaactattgaagcataacctttgcagtcccataatgacattttttgttt
aagac
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E812321] SGN-U445095 Nicotiana tabacum Build 2 41 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T641672 [Download][View] Facility Assigned ID: TL13.108L19F.060315T7
Submitter: None Sequencing Facility: ATCsub
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: