EST details — SGN-C1111

Search information 
Request: SGN-C1111Match: SGN-C1111
Request From: web userMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C1111Clone name: cLEC-10-O18
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: This clone is not found on any microarray
This clone has been mapped as cLEC-10-O18.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E201257Length: 568 bp (921 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E201257 [] (trimmed) GAAGCAGATCATGTAGGTTTCAGTTGCTCTACTAGTGGAGGTGCTGCTAGCAGAGGCATTTTGGGACCATTTGGTGTCATAGTAATTGCTGATCA
AACGCTATCTGAGCTAACGCCAGTTTACTTTTACATTTCTAAAGGAGCTGATGGTCGTGCAGAGACTCACTTCTGTGCTGATCAAACTAGATCCT
CTGAGGCTCCGGGAGTTGGTAAACAAGTTTATGGTAGTTCAGTACCTGTGTTGGACGGTGAAAAACATTCAATGAGATTATTGGTGGATCACTCA
ATTGTGGAGAGCTTTGCTCAAGGAGGAAGAACAGTCATAACATCGCGAATTTACCCAACAAAGGCAGTAAATGGAGCAGCACGACTCTTTGTTTT
CAACAATGCCACAGGGGCTAGCGTTACTGCCTCCGTCAAGATTTGGTCACTTGAGTCAGCTAATATTCAATCCTTCCCTTTGCAAGACTTGTAAT
CTTCTTTATTTCGNTTTTTTTTTCTTTTTCATTTGAAGGTTATTTCACCGACGTCCCATCAAGAAAGGGAAGAGGGAGATCAATATATGTAGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E201257] SGN-U578195 Tomato 200607 Build 2 342 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T24844 [Download] [View] Facility Assigned ID: TCABL93TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.976 Expected Error Rate: 0.0125 Quality Trim Threshold: 12.5