EST details — SGN-C17470

Search information 
Request: SGN-C17470Match: SGN-C17470
Request From: web userMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C17470Clone name: cLED-19-M19
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C182426 is on microarray TOM1: SGN-S1-1-1.1.8.19
This clone has been mapped as P33.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E237470Length: 437 bp (819 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E237470 [] (trimmed) AAGATCTCAAAAAAAAAAAAAAGAAGAAGAAGTTATGGCTCGTGGTAAGATCCAGATCAAGAAAATAGAAAACCAAACAAATAGACAAGTGACTT
ATTCAAAGAGAAGAAATGGGCTATTCAAGAAGGCTAATGAACTTACTGTTCTTTGTGATGCTAAAGTTTCAATTGTTATGATTTCTAGTACTGGA
AAACTTCATGAGTTTATAAGTCCCTCTATCACGACCAAACAATTGTTCGATCTGTACCAGAAGACTATTGGAGTTGATATTTGGACTACTCACTA
TGAGAAAATGCAAGAGCAGCTAAGGAAGCTAAAGGATGTGAATAGGAATCTACGAAAAGAGATCAGACAGAGGATGGGAGAAAGCCTAAATGATC
TGAACTATGAACAGTTGGAAGAACTCATGGAAAATGTGGACAATTCTCTGAAGCTTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E237470] SGN-U568823 Tomato 200607 Build 2 27 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T53384 [Download] [View] Facility Assigned ID: TOVCU82TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.932 Expected Error Rate: 0.0086 Quality Trim Threshold: 14.5