EST details — SGN-C18582

Search information 
Request: SGN-C18582Match: SGN-C18582
Request From: web userMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C18582Clone name: cLED-23-P14
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: This clone is not found on any microarray
This clone has been mapped as P71.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E239643Length: 385 bp (1021 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E239643 [] (trimmed) TTGCGAGTGTCCAAGTCCACAATATGTAGAGTGTCCTCTTCCTTTTATGGAGTTATGGTCTAATAGCCAAAGAGGAAAAAGAACATCAAGAAGGA
AAAGCTCTATGTGGTATTGAGGATTCTCATCAAATTAAAATGGATACTCTCTCCTAATAGAAAAGTTAACGAACAATTAATCATGAGGGAACTTC
ATGGCATTTGTAGCCTAACTTGAATAAGTTTCTTGGATTGGCTTGACCTAAATAGAAGGAAGCTCGAGCTACATTGCAAAAGCTTTTATCAGCTT
GTGATGAAGAAAATTGAGGATCCAACATCCCGTCAACAGTTCTATTCAAAGCGCAAGGATACCATCCTTAAGAAGTCCAATGAGTTGGCTGTTTT
ATGTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E239643] SGN-U569575 Tomato 200607 Build 2 11 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T54608 [Download] [View] Facility Assigned ID: TOVDN91TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.961 Expected Error Rate: 0.0094 Quality Trim Threshold: 14.5