EST details — SGN-C82625

Search information 
Request: SGN-C82625Match: SGN-C82625
Request From: web userMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C82625Clone name: cLET-20-K6
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: This clone is not found on any microarray
This clone has been mapped as cLET-20-K6.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E295134Length: 262 bp (951 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E295134 [] (trimmed) GTGAAGTGGCGTGCTTTGAGGTTTGACACTGTTAATTACTCTTGGGGTAGTGAAGCTGTTACTAGGAAGACCCGTTTATTGGATGTTGTCTACAA
TGCCTCAAACAACGAGTTGGTTAGAACACAAACTCTAGTGAAGAGTGCTATTGTGCAAGTTGATGCAGCTCCATTTAAACAGTGGTATCTCCAGC
ACTATGGTGTTGAAATTGGTCGCAAGAAGAAGAGTGCTGCCAAGAAGGAAGGAGAGGAGGTTGCTGAGGCTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E295134] SGN-U580349 Tomato 200607 Build 2 63 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T107548 [Download][View] Facility Assigned ID: TMECZ63TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.947 Expected Error Rate: 0.0086 Quality Trim Threshold: 14.5