EST details — SGN-C93338

Search information 
Request: SGN-C93338Match: SGN-C93338
Request From: web userMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C93338Clone name: cLEX-14-G23
cartOrder Clone
Library Name: cLEXOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: fruit-set stage/post-fruit loading

Microarray: This clone is not found on any microarray
This clone has been mapped as cLEX-14-G23.
Additional sequencing 
Clone: SGN-C192550 [TUS-65-O12] Trace: SGN-T344741 EST: SGN-E543866 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C192550 [TUS-65-O12] Trace: SGN-T344742 EST: SGN-E543867 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E305546Length: 682 bp (836 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E305546 [] (trimmed) GGTACAAACAAGATATGCCATTGTATATCCATTCCATATTATCGATCTTCTAATTGCTTGAATAACAAGTCTAGTTTTCATTGGAAGTTTTTTAG
ATGCATTAATGGCGTATCAACATTATCGATCACCATTTGGGGACACAACTTACACCAAAGTTTTTGTTGGTGGATTAGCATGGGAAACTCCAACA
GATGTAATGCGCCGGTATTTCGAGCAATTCGGAGAGATTCTTGAAGCTGTCATTATCACAGATAAAAACACTGGCAAATCTAAAGGATATGGCTT
TGTAACTTATCGTGATCCGGAATCTGCAAGACGGGCTTGTGATAACCCGAATCCGGTAATTGATGGAAGAAGAGCTAACTGTAACATCGCTTCTC
TTGGACGGCCTCGTCCTTCACCACCTCGAGGTAGGGGACAAGGAGGGAATCCTTATCAAGGAGGGGGAATTCCACAAGGGGCATCATCATCATCT
TACAGTGGGGTGGCAGGAGGAGCAGCAGCACCATTACCATTACATCCACCACCTGCAACTCCTATGATATATTCACCATATGGGTATGCAACGTA
CCCTCCTGATTATTACCATCAAGCTGCGGGGATGTACAATCCAAGGACGTACCAGCAAGCAGCAGCAGCAGCACATTATTATCAGCAAATGTATG
GAAGTTCATCATCACCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E305546] SGN-U586319 Tomato 200607 Build 2 13 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T118032 [Download] [View] Facility Assigned ID: TRXCA48TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.980 Expected Error Rate: 0.0072 Quality Trim Threshold: 14.5