Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

EST details — SGN-E109993

Search information 
Request: SGN-E109993Match: SGN-E109993
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C3335Clone name: cLEC-20-E10
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C3335 [cLEC-20-E10] Trace: SGN-T27606 EST: SGN-E205824 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E109993Length: 602 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5'
>SGN-E109993 [] (called/trimmed by facility)
GACTAATTTTAATCGTAATATATATTGATATTAAACAATATGATACAAAATGATGTTGATCTTCATGAACATAACAATTTGATGGTCCAAAAACC
CAAGTCAGTAATAAAATCACAAATTATTAGTATCATATTCCCACCCCAAGTTTACCAGGTCAGTAAAAACAAAACACAACCTTGTGAATAGGAAC
CAAACACCAAGGCTTTAGCCATTCGTAAAGAACTCTTCATGCTAGACGTATGGTAAAGCATTAGGTATTCAAGGTTCAGTCACTAGACAACAGAA
TCTGGAAAGGAGAGGAGGAACTCCAGTGCTTGTTTTCTATTCGGGAGAAGTTTATGAACCAATAGATATCTAAAGTTTGAAGAGTTCTGGAAGAT
GAGCATTTGTAAGCTTAGTCCTCTTGCTAATCTCATGCTTCTTCTTTTTGGTTTTGGGCTTGGGAGCAATGCCATGGACTTGTGCCATTGCCCTT
CTCTTTGCAGTGTTGGTAGCAGGTTTCATCCCGTTCTTCTGCAGATCCCTTTCGATATCAAGCATGTCACGTGGTAATTCAATACCTCTGAATAG
CTGTTTCAAATCATCATCAACCTTAATGGGTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T27606 [Download] [View] Facility Assigned ID: TCACZ29TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence