EST details — SGN-E14443

Search information 
Request: SGN-E14443Match: SGN-E14443
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C113928Clone name: cTOA-22-D13
cartOrder Clone
Library Name: cTOAOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: 0-3mm flower buds from full grown plants

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C113928 [cTOA-22-D13] Trace: SGN-T127474 EST: SGN-E315447 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E14443Length: 492 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5'
>SGN-E14443 [] (called/trimmed by facility)
GATGGTAGAATTCCGTTGATTTGAGGAGATAGGGGCTTCGGAGTTTTTAAAATGGCGGAGCCTTCGAGTTCTCGAATTACAATCACCTTAGGACG
CAGCGGTCAGGTGGTAAAGAAGGCAGGATCTGTATTAGATCATCCCTTTCCTGATTCAGGGCCAGCAGTTGGGAGTAAACGGTCTGTCAGAGATA
GACTAGGTAGCATTGCAGATTCAACTACTGAATTCAATAATAAACGTCAGCGAGGAAATGGAAGTAGATTGGGCTCTAGTGGCATTGAAGATGGG
CGGCTTGGTAAAGATGACCTGCGATATAAAATCTTGCGGAAAGCTGCGCTTGACCGAGGTCAAAGCAATGGCCAGCAGAATGGGGTGGACCTTCG
TGATTTCCTATCAAGGCCTGCTCAGTCTTCAACAGCAAAACCTAGTTCACGGCAGCACATACCTGATCAGAGGGATAATAGACGACGAGTACCTG
AGCCGAGGGATAGTAGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T127474 [Download] [View] Facility Assigned ID: TFADI19TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence