EST details — SGN-E90470

Search information 
Request: SGN-E90470Match: SGN-E90470
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C128784Clone name: cTOC-8-N12
cartOrder Clone
Library Name: cTOCOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: 8mm to pre-anthesis flower buds from full grown plants

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C128784 [cTOC-8-N12] Trace: SGN-T137488 EST: SGN-E324822 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E90470Length: 583 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5'
>SGN-E90470 [] (called/trimmed by facility)
GGAAAGATGACAGCATCAAGTTTTGTATCTATGGCTGAAAAGATTATTAAGCCTCATTCTCCTACCCCTTTTTCAGTTAAGCGTTACAATCTTTG
TCTAATGGATGAAATCATGGTTCCAGTCTACATGCCAATTGTAGCCTTTTATCCTAACCCCTCTAAAACACCAGAACAAGTATCCAACATACTTG
AAGATTCACTATCCAAAGTTTTATCCTCTTACTATCCATTTGCTGGAACACTCGGATCAGATAACGCTACTTTTGTCGATTGCAATGACAGGGGA
GCTAAATCTATACAGGTTCGATACGATTGTCCAATGTCTGAAATAGTCAATCTTCCGGATACTGGCCCTGAATATCTACCTTTTGCTAAAGGTAC
GCCTTGGAGTTCAACTCCAGAGGAACAAAGTTTACTAGTTGTTCAATTAAGCCATTTTAATTGCGGAGGATTAGGTATAAGTGCTAGGCTATCCC
ATAAAATTGCTGATGGATGCACGCTCGCCAATTTCATTAGTGATTGGGCTTCCGTAGCTCGTGATGACAACGCGAATATACCTTCCCCTCAATTG
ATTGGATCGTCCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T137488 [Download] [View] Facility Assigned ID: TFCBF78TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence