Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

Due to a hardware issue, SGN was briefly unavailable earlier today. We apologize for any inconvenience.

EST details — SGN-E95596

Search information 
Request: SGN-E95596Match: SGN-E95596
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C119753Clone name: cTOB-21-K17
cartOrder Clone
Library Name: cTOBOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: 3-8mm flower buds from full grown plants

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C119753 [cTOB-21-K17] Trace: SGN-T133066 EST: SGN-E320197 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E95596Length: 712 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5'
>SGN-E95596 [] (called/trimmed by facility)
GGGCCAGACCAAATATGCTAACCCCCTAAGGGATATAGTTCCTATGGGCTCTGCCAGATTCACCATGAGTAATGATTTGTGGTATGGACCTGACC
GTGTCAAGTACTTGGGACCATTTTCTGCTCAAACTCCTTCATACTTGACTGGAGAATTCCCTGGTGATTACGGATGGGATACTGCTGGTTTATCT
GCTGATCCCGAGGCCTTTGCTAAGAACAGAGCTCTTGAGGTTATCCATGGGAGATGGGCCATGCTTGGAGCTTTTGGTTGCATTACACCAGAAGT
TCTTGAAAAATGGGTAAAAGTGGACTTCAAAGAACCAGTATGGTTCAAAGCTGGAGCCCAGATCTTCAGTGAAGGTGGGCTGGACTATTTGGGCA
ACCCAAACCTTGTCCATGCTCAGAGCATTCTAGCAGTATTGGGCTTCCAAGTTGTACTAATGGGCCTTGTAGAAGGTTTCAGAATTAATGGGCTT
CCTGGAGTTGGTGAAGGCAACAATCTCTACCCAGGTGGACAGTACTTTGACCCATTGGGCCTAGCAGATGACCCAACAACTTTCGCGGAACTCAA
GGTCAAGGAAATCAAGAACGGAAGATTAGCTATGGTCTCCATGTTTGGAATTCTTCGTTCCAGCTATTGTCACCGGCAAAGGCCCACTTTGAAAT
CTATTGGATCACCCTTGACACCTGGTGCTACAATGCATGGGTTACGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T133066 [Download] [View] Facility Assigned ID: TFBDC69TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence