EST details — SGN-T25244

Search information 
Request: TCAAZ16THMatch: SGN-T25244
Request From: web userMatch Type: Chromatogram internal Identifier
Clone information 
SGN ID: SGN-C14200Clone name: cLEC-7-C8
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C172877 is on microarray TOM1: SGN-S1-1-6.3.20.11
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C172877 [TUS-14-K19] Trace: SGN-T195756 EST: SGN-E394430 Direction: 5' Facility: INRA
Clone: SGN-C172877 [TUS-14-K19] Trace: SGN-T200443 EST: SGN-E399527 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E201962Length: 418 bp (758 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E201962 [] (trimmed) CAATGACGAAAGAGGGAAAGAATGTGAAAAGAATCAAATTGGGTTCAGAGGGACTTGAAGTATCTGTTCAAGGACTTGGTTGTCTGGGTATGTCC
GATTTCTACGGTCCGCCCAAACCCGAACCCGATATGATTGAACTAATACACCATGCCATTAACTCCGGCATAACATTTTTCGATACTTCAAATAG
TTATGGGCCTTACACTAATGAAATCCTCCTTGGCAAGGCTTTGAAGGGAGGAATGAGGGAACGAGTCGAGTTAGCAACAAAATTTGGTATACATT
TTGCAGATGGAAAGATAGAAGTACGTGGAGAGCCATAATATGTAAGGGCAGCATGCGAGGCTAGCTTAAAGCGACTTGATGTTGATTGCATAGAC
TTGTACTACCAGCACCGGATTGATACACGCGTGCCCAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E201962] SGN-U571241 Tomato 200607 Build 2 21 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T25244 [Download][View] Facility Assigned ID: TCAAZ16TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.971 Expected Error Rate: 0.0029 Quality Trim Threshold: 14.5