Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

EST details — SGN-T102670

Search information 
Request: TMEAC48THMatch: SGN-T102670
Request From: web userMatch Type: Chromatogram internal Identifier
Clone information 
SGN ID: SGN-C82285Clone name: cLET-1-H23
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C179466 is on microarray TOM1: SGN-S1-1-1.2.2.10
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C179466 [TUS-31-N8] Trace: SGN-T185598 EST: SGN-E373460 Direction: 3' Facility: INRA
Clone: SGN-C179466 [TUS-31-N8] Trace: SGN-T185599 EST: SGN-E373461 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E292396Length: 529 bp (890 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E292396 [] (trimmed) GTATATTCAAGTGAAACATGTGCTGATGCATGGATTGAGAAGGAGGTGGTCGCTTTAAGGCAGGATGGGTGTCCAAAAGTATGGGTTGTCACATC
TGATCATAATCAGCAGCATGCAGCCTATGGAGCAGGGGCTTTTGTTTGGAGCTGCAAGGCATTAATCTCTGAGATCAAAGCTTCACACAAGGAGG
TTGAGAGAATGCTGCGGGAACATAGATCTACTTCTATGCAAGGTAAATTGTTAAAGCACAACCTCGCTGCAGAAGTTGTGGATGCTCTTAAGGAC
CTCAGGGACCAGCTTTCTCAAAATGAGATGCGCAGATGACAAGTCTCACAAAAGGCTATGTCAGAGACAAAACAGAATTTTAAGTCAATGGATGT
TAAGTTCTAACTGCACTAGTAACTTTGTGACAGTATATTTGGATGAGTGTTATCGATACATGTATACTAAATGTTTCAACCACACGTGTACATCT
TGTGCTGATGATACGTTAAACATGCAAAGATCATGTTCCTGCCTCAAAAAAGCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E292396] SGN-U597516 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T102670 [Download] [View] Facility Assigned ID: TMEAC48TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.961 Expected Error Rate: 0.0049 Quality Trim Threshold: 12.5