EST details — SGN-T102902

Search information 
Request: TMEAG54THMatch: SGN-T102902
Request From: web userMatch Type: Chromatogram internal Identifier
Clone information 
SGN ID: SGN-C84876Clone name: cLET-2-J11
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E291361Length: 532 bp (763 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E291361 [] (trimmed) CCAAACTCAACTTTATATGCAGGAGAAAGCTGATATTAACAGTAAACATCGATAAGAATACTGAACAGGACCTTCAGTTAGTGGTGGAGAGAGGT
TCGCGAATACTAATAAGCAAGTCAAGAGCTGAGCTAGTAGACTTCACAAGCCATGCAAATGTATCAAAAAGACCAGGCCATTATGTGATCTATTG
GGAAATCAAAGGTGATGTTGATGAAAATGTTTTTGGAGAGTGTTGTAGGGAGATGGATGCATCTTTTGTTGATCATGGATATGTTGTATCAAGAA
AAACAAATTCAATTGGACCATTAGAACTTTGCATTGTGGAAAGAGGTACTTTCAAGAAGATTTTGGAACATTTTATTGGAAATGGAGCAGCATTA
AGCCAATTCAAGACTCCAAGATGCACTAGCAACCAAGTACTATTAAGAATCCTTAATGTATGTACCATTAAAAGGTTTTATAGCACAGCTTATGG
TTGATACAATGTTTTTGTAACATAAGTGATCAATTTGCATTGATATTTACTTTATTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E291361] SGN-U567093 Tomato 200607 Build 2 11 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T102902 [Download] [View] Facility Assigned ID: TMEAG54TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.932 Expected Error Rate: 0.0033 Quality Trim Threshold: 12.5