Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

Due to a hardware issue, SGN was briefly unavailable earlier today. We apologize for any inconvenience.

EST details — SGN-T107574

Search information 
Request: TMEDA27THMatch: SGN-T107574
Request From: web userMatch Type: Chromatogram internal Identifier
Clone information 
SGN ID: SGN-C82547Clone name: cLET-20-F5
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E295160Length: 467 bp (963 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E295160 [] (trimmed) GAAGTTGTTGATGATGAGTCGTGGATTATGGGCTTCTTAGACGTCATTGACCCAGCGATTGACAGCATAAAGAGGCTCTTGAATCTAGATCAGAA
CTCTTACTACAAGGTAAAAGAGTCTGCTTCTAATACTACTGCTGGAGACGACGTTGAGGGGAGCACAGAAGAATCAGCTTCTCCCTCCTCGGCTA
ACGTCAATGACAATAACATAGATACAGGAAGTGGCTTTGATTTAGATGATTTTATCAGTGTAATGCTGTCTTTAGACCCTTCAAAGCTGGAAGTT
CAGCTTACAACATCTCTTAAGGACCCTCCGAAAATCGCCAGAACTACTAATGGGGTGTGGCGACCATCGACAAAGACTAGTAGAACATCAACAAC
ACTTTGATTTTACAACAACAACGACATACTTAATGTAACCTCACTAGTGTGGTCTGGGAGGGCGGAGGACGAAAGGTGATGTGTTGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E295160] SGN-U576042 Tomato 200607 Build 2 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T107574 [Download] [View] Facility Assigned ID: TMEDA27TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.982 Expected Error Rate: 0.0155 Quality Trim Threshold: 12.5