Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

EST details — SGN-T107690

Search information 
Request: TMEDA43THMatch: SGN-T107690
Request From: web userMatch Type: Chromatogram internal Identifier
Clone information 
SGN ID: SGN-C82565Clone name: cLET-20-H13
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E295276Length: 472 bp (962 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E295276 [] (trimmed) TTGTCTCAGAAAGTGTGGAGGATCAAACAGAGCAGGTTCTCAAGAATATGGGGGAGATACTTAAAGCAAGTGGTGTTAGCTACTCCTCAGTTGTT
AAGACAACTATCTTGTTAGCTGATCTGAATGACTTCAAGAAAGTGAATGAGATTTATGCAAAATATTTTCAAGCTCCTGCACCAGCTCGGGCAAC
TTATCAGGTAGCAGCACTGCCAATGAATGCAAGGATTGAAATTGAGTGCATAGCAGCATTATGATTCTCCCTTACCTATTCATTCAACAACTTAT
TAGACCTCGAAAAGGAGAAAGTCTGCTGACTTCCTAGCCTACATTCGTAGATTTAATAAGCCTGGAGTTAGCTACTAGTCCAGGAGCCCTTGTCT
AACTTCGCGGAGCTGAGAATAAACTTTATTTAAGAACGTATTGTAACTGATCTGCATGAGTATTACATATACAATTGTGCTACTCTATTGGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E295276] SGN-U563290 Tomato 200607 Build 2 26 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T107690 [Download] [View] Facility Assigned ID: TMEDA43TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.964 Expected Error Rate: 0.0196 Quality Trim Threshold: 12.5