EST details — SGN-T107886

Search information 
Request: TMEDF54THMatch: SGN-T107886
Request From: web userMatch Type: Chromatogram internal Identifier
Clone information 
SGN ID: SGN-C82787Clone name: cLET-21-J12
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E293764Length: 472 bp (884 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E293764 [] (trimmed) AATCGCGAAACAGATCAGTGCGATTTCCAGCTTGAGTAAAATCATGGATGAGGCTGCAGAGCTAAGGTATTATGAAGAGGAGGATACAGCAGGGA
TGAAAACACTGAAAGGGGCAACCTCAGGTCTAGTTGCTGGTACACTTTGGGGTGCCATTATTGCCACTTGGCATGATGTACCCCGTGTTGAGAGA
AATGTTGCTCTTCCTGGCTTGATCCGGACATTGAAAATGATGGGAAACCACGGGCTTACCTTTGCTGCTATTGGCGGAGTCTATATAGGGGTAGA
ACAGCTGGTGCAGAACTATAGGGTGAAAAGAGATTTTATTAATGGAGCAGTGGGTGGATTCGTTGCTGGTGCTTCTGTGCTGGGTTACAAAGGAA
GGAGTATTCCAACAGCTCTGTCAGCTGGGGCTGCACTTGCAGTCACTTCTGGTATAATTGATGGACTATGCGCGACCACAAGAACTGACAAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E293764] SGN-U581197 Tomato 200607 Build 2 35 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T107886 [Download] [View] Facility Assigned ID: TMEDF54TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.970 Expected Error Rate: 0.0125 Quality Trim Threshold: 12.5