EST details — SGN-T50520

Search information 
Request: TOVAZ40THMatch: SGN-T50520
Request From: web userMatch Type: Chromatogram internal Identifier
Clone information 
SGN ID: SGN-C24177Clone name: cLED-7-G8
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C185197 is on microarray TOM1: SGN-S1-1-6.1.12.16
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C185197 [TUS-46-M3] Trace: SGN-T198955 EST: SGN-E397629 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E232011Length: 632 bp (779 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E232011 [] (trimmed) CAAAGTCGTGGCCGTGGGAAGATGGCACCAATTCCCTGGCTATGGCCAAGAGAAGACTGAGAGCCAACTTTGAATTCCTGGAGAAACTTGGAGTA
GAAAGATGGTGCTTCCACGATAGGGACATCGCTCCAGAGGGAAAGACCCTTGAGGAAACAAATGCAAACTTGGATGAAGTGGTGGCTCTTGCCAA
AGAGCTTCAGGGAGATAAATTTCATCTTCTGTGGGGTACCGCTCAATTGTTCCTCCAGCCTCGCTACATGCATGGTGCTGCTACTAGCTCTGAAT
TAGGTGTATATGCATATGCTGCTGCTCAGGTCAAGAAAGCCATGGAGGTTACACATCATCTTGGGGGAGAGAATTATGTCTTTTGGGGTGGTCGA
GAAGGTTACCAGAGCCTCCTGAACACAGATATGGAAAGAGAACTTAACCATATGGCAAGGTTCATGGAAGCTGCTGTCGCTTACAAAAAGAAGAT
TGGCTTCAATGGAACATTACTAATTGAACCAAAGCCTCAGGAGCCAACAAAACACCAGTATGACTGGGATGCTGCCACTTCTGCTAATTTCTTAC
GCAAATATGGGCTTATAGGAGAGTTCAAATTGAACATCGAGTGCAACCATGCCACGTTGGCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E232011] SGN-U574414 Tomato 200607 Build 2 72 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T50520 [Download] [View] Facility Assigned ID: TOVAZ40TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.975 Expected Error Rate: 0.0050 Quality Trim Threshold: 14.5