Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

EST details — SGN-T98267

Search information 
Request: TPSAR65THMatch: SGN-T98267
Request From: web userMatch Type: Chromatogram internal Identifier
Clone information 
SGN ID: SGN-C78427Clone name: cLES-5-K10
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E285784Length: 459 bp (775 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E285784 [] (trimmed) CTTGATGTCATTGCCATCAATGACTCTGGCGGTGTCAAGCAAGCCTCTCACCTCCTCAAGTATGACTCTACCCTCGGCATCTTCGATGCTGATGT
TAAGCCTGTTGGTACTGATGGCATCTCTGTTGATGGAAAGATCATCAAAGTCGTTTCCGATCGTAACCCCATCAATCTCCCCTGGAAGGATCTTG
GTGTTGACTTGGTCATTGAAGGTACCGGAGTTTTTGTCGATCGAGAGGGTGCTGGCAAGCATATCCAAGCTGGAGCTAAGAAAGTCCTCATCACT
GCCCCCGGAAAGGGTGATATTCCTACCTATGTCGTTGGTGTCAATGCAGACCTTTACAGCCCTGATGAGTCCATTATCAGCAATGCTTCTTGCAC
CACAAACTGTCTTGCTCCTTTTGTCAAAGTCCTTGACCAAAAATTCGGCATAATCAAAGGGACCATGACAACAACACAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E285784] SGN-U577274 Tomato 200607 Build 2 65 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T98267 [Download] [View] Facility Assigned ID: TPSAR65TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.978 Expected Error Rate: 0.0131 Quality Trim Threshold: 14.5