EST details — SGN-T177708

Search information 
Request: TPTAD53THMatch: SGN-T177708
Request From: web userMatch Type: Chromatogram internal Identifier
Clone information 
SGN ID: SGN-C109914Clone name: cLPT-1-J10
cartOrder Clone
Library Name: cLPTOrganism: Solanum pennellii (formerly Lycopersicon pennellii)

Tissue: leaf trichomes
Development Stage: 4-8 weeks old

Microarray: This clone is not found on any microarray
This clone has been mapped as cLPT-1-J10.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E366283Length: 384 bp (979 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E366283 [] (trimmed) ACAGTGGGAAGATATTTCCGAGTGGAATATTCGGCGGACTCGTATAAGAAAGCGGTGGACTCAGCAATTCAGAAACTCAGAAGCCAGGAAGGAAA
TCATAATGAAGACACCGACGATGCTGCTGAAACGCCGTCAACTCCAAAAACACCAATAGAGCTGGCGATTGATTTCATTCTTCATGATTTTGAAA
TGGCAGAAGTTGAGCCAATATCAACCTATGTAGATTTTGGTGAAAGAGAATTTCTGGTTGCTGATGAAAGAGGATATGAACATTTGCTTTATAAA
ATGGCAGAAAATTTTCTTCTTACCTGTGAGGGTAAAATTATGGACAGTGGACTCAAGCTCAATACGGTTGTTCGGGAAGTGCACCACTCGAGAAA
CGGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E366283] SGN-U565692 Tomato 200607 Build 2 8 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T177708 [Download] [View] Facility Assigned ID: TPTAD53TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.964 Expected Error Rate: 0.0078 Quality Trim Threshold: 14.5