EST details — SGN-C14164

Search information 
Request: 14164Match: SGN-C14164
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C14164Clone name: cLEC-7-B13
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C172862 is on microarray TOM1: SGN-S1-1-5.3.20.3
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C172862 [TUS-14-K4] Trace: SGN-T195245 EST: SGN-E393919 Direction: 3' Facility: INRA
Clone: SGN-C172862 [TUS-14-K4] Trace: SGN-T195393 EST: SGN-E394067 Direction: 3' Facility: INRA
Clone: SGN-C172862 [TUS-14-K4] Trace: SGN-T195393 EST: SGN-E399073 Direction: 3' Facility: INRA
Clone: SGN-C172862 [TUS-14-K4] Trace: SGN-T195686 EST: SGN-E394360 Direction: 5' Facility: INRA
Clone: SGN-C172862 [TUS-14-K4] Trace: SGN-T200217 EST: SGN-E399074 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E202160Length: 471 bp (863 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E202160 [] (trimmed) ATCTCCTAAACTCTCCACTCAAAAAACAAACCAAACATACCAAAAAAATCAAAGAAAAAAGAGAAAGCATTGTAAACAAAATGAATGAAATGGTA
CTAAACAATATCAATTCAATTCTTGAAGCTTTACAAGCTAACCCTATACTAATCTTCTTCTTCATCATCCCTCTCTTCTTCTTATACCTTTTTTC
GATGTCCCGCCGTAAACGTTATCCTCCAGGACCATTAGGCTGGCCTCTCATTGGTAACATGATGATAATGGACCAGTTAACTCACCGTGGTCTTG
CCAAACTTGCACAAAAATATGGTGGCGTTTTTCACCTCAAAATGGGTTATGTCCACAAAATTGTTATATCTGGTCCAGAAGAAGCTCGTCAAGTA
CTGCAGGTACAAGACAACATATATTCGAATCGTCCAAAGACCGTAGCGATAAGTTACCTAACGTACGATCGTGCGGACATGGCTTTTGCTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E202160] SGN-U571791 Tomato 200607 Build 2 34 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T25442 [Download][View] Facility Assigned ID: TCABA07TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.962 Expected Error Rate: 0.0138 Quality Trim Threshold: 14.5