EST details — SGN-C14372

Search information 
Request: 14372Match: SGN-C14372
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C14372Clone name: cLEC-7-L16
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C172960 is on microarray TOM1: SGN-S1-1-3.3.20.4
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C172960 [TUS-14-O6] Trace: SGN-T195409 EST: SGN-E394083 Direction: 3' Facility: INRA
Clone: SGN-C172960 [TUS-14-O6] Trace: SGN-T195409 EST: SGN-E399100 Direction: 3' Facility: INRA
Clone: SGN-C172960 [TUS-14-O6] Trace: SGN-T195702 EST: SGN-E394376 Direction: 5' Facility: INRA
Clone: SGN-C172960 [TUS-14-O6] Trace: SGN-T195702 EST: SGN-E399101 Direction: 5' Facility: INRA
Clone: SGN-C172960 [TUS-14-O6] Trace: SGN-T199533 EST: SGN-E398207 Direction: 3' Facility: INRA
Clone: SGN-C172960 [TUS-14-O6] Trace: SGN-T199557 EST: SGN-E398231 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E202069Length: 407 bp (997 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E202069 [] (trimmed) TTATTCTTTTAGTAACTCTTCCTATTGTACTCAATTTCCTAGCAAAAAAGGATAGGAAAAATGTTATGCCACCTGGTCCTTTAGGGTTACCATTT
ATTGGAAATTTGCATCAATACGATGGTTTAACCCCTCATATTTATTTTTCGAAACTTGCCAAGAAATATGGAAAAATATTTTCATTAAAACTTGG
GTCTACTCCAATAGGTGTAATTTCTTCAGCAAAATTAGCGAAAGAAGTGTTAAAAATACAAGATTTAACATTTTGTAGTAGACCTTCTTTTCTTG
GTCAACAAAAATTGTCTTACAATGGTCGTGATATTGGCTTTGCACCTTATAATGACTATTGGAGAGAAATGCGAAAAATTTGCGTTGTTCATTTG
TTCAATTTAAAAAAAGGACAATCCTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E202069] SGN-U577528 Tomato 200607 Build 2 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T25351 [Download][View] Facility Assigned ID: TCABB68TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.929 Expected Error Rate: 0.0207 Quality Trim Threshold: 14.5