EST details — SGN-C183840
| Search information |
| Request: 183840 | Match: SGN-C183840 |
| Request From: SGN database generated link | Match Type: cDNA clone internal identifier |
| Clone information |
| SGN ID: SGN-C183840 | Clone name: TUS-43-D14 |
| ||
| Library Name: TUS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:
Microarray: SGN-C183840 is on microarray TOM1 spot ID 1-1-3.4.19.20 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C6962 [cLEC-37-G14] | Trace: SGN-T31199 | EST: SGN-E208208 | Direction: 5' | Facility: TIGR |
| Clone: SGN-C183840 [TUS-43-D14] | Trace: SGN-T198095 | EST: SGN-E396769 | Direction: 3' | Facility: INRA |
| Sequence |
| Sequence Id: SGN-E396616 | Length: 139 bp (897 bp untrimmed) |
| Status: Current Version | Direction: 5' [See links to 3' reads above] |
>SGN-E396616 [] (trimmed)
ACCCTTATGTTTATCAACATCATCAGAGTTCACAAATAATTATGACGGCTGTAATAGGATTATTCCTCAATTATTACGAGGAGTTAATTCCTCAT
TTTCTTCATTTTCAAACTCCAATAATGTTCATAGGGAAAGACAT
TTTCTTCATTTTCAAACTCCAATAATGTTCATAGGGAAAGACAT
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E396616] | SGN-U570502 | Tomato 200607 | Build 2 | 2 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T197942 [Download][View] | Facility Assigned ID: FA0AAD31DB07RM1 |
| Submitter: Koni | Sequencing Facility: INRA |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.914 | Expected Error Rate: 0.0337 | Quality Trim Threshold: 14.5 |


